Incidental Mutation 'R1478:Fscn3'
ID165616
Institutional Source Beutler Lab
Gene Symbol Fscn3
Ensembl Gene ENSMUSG00000029707
Gene Namefascin actin-bundling protein 3
SynonymsOTTMUSP00000023543; fascin (testis); fascin 3
MMRRC Submission 039531-MU
Accession Numbers

Genbank: NM_019569; MGI:1890386

Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R1478 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location28427789-28438622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28430568 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 246 (M246V)
Ref Sequence ENSEMBL: ENSMUSP00000031719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020717] [ENSMUST00000031719] [ENSMUST00000064377] [ENSMUST00000169841]
Predicted Effect probably benign
Transcript: ENSMUST00000020717
SMART Domains Protein: ENSMUSP00000020717
Gene: ENSMUSG00000020440

DomainStartEndE-ValueType
ARF 1 180 5.83e-121 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031719
AA Change: M246V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031719
Gene: ENSMUSG00000029707
AA Change: M246V

DomainStartEndE-ValueType
Pfam:Fascin 24 138 1e-29 PFAM
SCOP:d1dfca2 146 260 2e-48 SMART
Pfam:Fascin 271 381 2.1e-26 PFAM
SCOP:d1dfca4 386 498 3e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064377
SMART Domains Protein: ENSMUSP00000067395
Gene: ENSMUSG00000029708

DomainStartEndE-ValueType
coiled coil region 13 61 N/A INTRINSIC
low complexity region 93 109 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
coiled coil region 156 315 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
Blast:H2B 492 590 3e-8 BLAST
low complexity region 613 631 N/A INTRINSIC
coiled coil region 659 701 N/A INTRINSIC
Grip 719 766 8.28e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147036
Predicted Effect probably benign
Transcript: ENSMUST00000169841
SMART Domains Protein: ENSMUSP00000127281
Gene: ENSMUSG00000020440

DomainStartEndE-ValueType
ARF 1 180 5.83e-121 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,056 L170Q probably damaging Het
Aacs T A 5: 125,503,223 I204N possibly damaging Het
Acaca A G 11: 84,372,627 T2025A probably damaging Het
B4galt3 C T 1: 171,276,365 R170C probably benign Het
BC028528 T C 3: 95,891,959 probably null Het
Ccdc73 A T 2: 104,907,610 Q17L possibly damaging Het
Ccdc73 A G 2: 104,914,667 T50A possibly damaging Het
Ccdc83 T C 7: 90,259,469 D19G probably damaging Het
Cct8l1 T C 5: 25,517,769 V494A probably benign Het
Chd1 T C 17: 15,739,507 F663L probably damaging Het
Chn2 A T 6: 54,293,080 E319V probably damaging Het
Cnnm1 T C 19: 43,471,856 V679A probably damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Cyp3a11 G T 5: 145,858,771 L457I probably benign Het
Dera T A 6: 137,830,195 S214T possibly damaging Het
Dmtf1 A G 5: 9,121,404 V501A possibly damaging Het
Dnpep A G 1: 75,316,027 V114A probably damaging Het
Dscam C T 16: 96,790,910 V722M probably benign Het
Dsp A G 13: 38,181,138 N499S probably damaging Het
Ecd A T 14: 20,346,657 Y53* probably null Het
Esyt3 T C 9: 99,318,066 T692A probably benign Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fat1 T A 8: 45,025,622 N2545K probably damaging Het
Fndc3a A G 14: 72,557,632 probably null Het
Gde1 G T 7: 118,691,784 T106K probably benign Het
Gjc2 A G 11: 59,177,608 I16T possibly damaging Het
Hacd4 A T 4: 88,423,023 M168K probably damaging Het
Hmx3 A G 7: 131,544,097 E178G probably damaging Het
Htt A G 5: 34,803,827 Y266C probably damaging Het
Kif27 G T 13: 58,303,545 R990S probably damaging Het
Krtap22-2 A T 16: 89,010,646 Y21* probably null Het
Lrrc41 T A 4: 116,095,208 L661* probably null Het
Lrrc63 T C 14: 75,125,984 T236A probably benign Het
Mmp13 T C 9: 7,272,892 L84P probably damaging Het
Myh8 T C 11: 67,292,725 I754T probably benign Het
Neb A C 2: 52,175,607 D5961E probably benign Het
Nlrx1 T C 9: 44,264,077 H134R probably benign Het
Npepps A T 11: 97,226,847 M542K probably benign Het
Nup160 C T 2: 90,679,399 probably benign Het
Olfr402 T A 11: 74,155,137 probably null Het
Olfr952 T A 9: 39,426,592 T160S possibly damaging Het
Pikfyve T C 1: 65,262,977 probably null Het
Ppp6r1 A T 7: 4,640,378 probably null Het
Prss33 A G 17: 23,835,098 W45R probably damaging Het
Ptprf A T 4: 118,212,105 Y980* probably null Het
Qrich1 T C 9: 108,559,332 V743A probably benign Het
Rev3l G A 10: 39,783,333 probably null Het
Samd9l A T 6: 3,376,369 N297K probably benign Het
Sap130 A G 18: 31,680,474 H528R possibly damaging Het
Slc9b2 T C 3: 135,326,102 V241A probably benign Het
Snx14 A T 9: 88,394,528 V577E probably benign Het
Srrm2 T C 17: 23,815,902 S507P probably benign Het
Stat2 A G 10: 128,282,100 probably null Het
Susd5 T C 9: 114,096,684 F545S probably benign Het
Tnnt2 A G 1: 135,848,026 T107A probably benign Het
Trappc6b T A 12: 59,048,167 I41F possibly damaging Het
Ttn T A 2: 76,852,073 probably benign Het
Vmn1r88 A C 7: 13,177,951 D78A probably damaging Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Xpc C T 6: 91,508,528 D122N possibly damaging Het
Xpo1 C T 11: 23,291,623 A890V probably damaging Het
Zfp493 A G 13: 67,786,561 H211R probably damaging Het
Zfp958 A T 8: 4,629,190 H405L probably damaging Het
Other mutations in Fscn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Fscn3 APN 6 28430506 missense probably benign 0.43
IGL01312:Fscn3 APN 6 28434470 missense probably damaging 0.99
IGL01634:Fscn3 APN 6 28430538 missense probably damaging 1.00
IGL01899:Fscn3 APN 6 28436079 missense probably damaging 1.00
IGL01928:Fscn3 APN 6 28430182 missense possibly damaging 0.65
IGL02334:Fscn3 APN 6 28428154 unclassified probably null
IGL02959:Fscn3 APN 6 28435998 missense possibly damaging 0.93
IGL03201:Fscn3 APN 6 28430605 missense probably benign 0.07
IGL03202:Fscn3 APN 6 28434452 missense probably benign 0.10
IGL03227:Fscn3 APN 6 28434430 missense probably benign 0.00
0152:Fscn3 UTSW 6 28429967 unclassified probably benign
R1502:Fscn3 UTSW 6 28435623 missense probably benign 0.05
R1955:Fscn3 UTSW 6 28430236 missense possibly damaging 0.82
R2122:Fscn3 UTSW 6 28430389 missense probably benign 0.18
R2135:Fscn3 UTSW 6 28431584 missense probably benign 0.02
R3713:Fscn3 UTSW 6 28428092 missense possibly damaging 0.89
R3715:Fscn3 UTSW 6 28428092 missense possibly damaging 0.89
R3778:Fscn3 UTSW 6 28430032 missense possibly damaging 0.72
R4572:Fscn3 UTSW 6 28430635 unclassified probably null
R4745:Fscn3 UTSW 6 28435628 missense probably damaging 0.98
R4764:Fscn3 UTSW 6 28436201 makesense probably null
R4794:Fscn3 UTSW 6 28430596 missense probably damaging 1.00
R5738:Fscn3 UTSW 6 28430031 missense possibly damaging 0.56
R5951:Fscn3 UTSW 6 28436174 missense possibly damaging 0.88
R5994:Fscn3 UTSW 6 28430295 missense probably benign
R6595:Fscn3 UTSW 6 28430175 missense probably damaging 1.00
R7323:Fscn3 UTSW 6 28431545 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GACGCAGCAATCCCCTGCC -3'
(R):5'- TGAACACAGTTTCCTCTTTCTAGCACC -3'

Sequencing Primer
(F):5'- ATCCCCTGCCTAGAGGAATG -3'
(R):5'- AGCACCTAGCCCTCTCC -3'
Posted On2014-03-28