Incidental Mutation 'R1478:Mmp13'
ID165631
Institutional Source Beutler Lab
Gene Symbol Mmp13
Ensembl Gene ENSMUSG00000050578
Gene Namematrix metallopeptidase 13
SynonymsMMP-13, interstitial collagenase, Clg, Mmp1, Collagenase-3, collagenase-1
MMRRC Submission 039531-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1478 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location7272514-7283331 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7272892 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 84 (L84P)
Ref Sequence ENSEMBL: ENSMUSP00000015394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015394]
PDB Structure
STRUCTURE OF RECOMBINANT MOUSE COLLAGENASE-3 (MMP-13) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000015394
AA Change: L84P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015394
Gene: ENSMUSG00000050578
AA Change: L84P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:PG_binding_1 33 92 5.3e-13 PFAM
ZnMc 110 269 3.76e-59 SMART
HX 291 333 9.62e-8 SMART
HX 335 378 9.91e-10 SMART
HX 383 430 2.52e-11 SMART
HX 432 472 1.81e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family that plays a role in wound healing, skeletal development and bone remodeling. The encoded protein is activated by the removal of an N-terminal activation peptide to generate a zinc-dependent endopeptidase enzyme that can cleave various native collagens, including types I - IV, X and XIV. Mice lacking the encoded protein display profound defects in growth plate cartilage as well as a delay in the endochondral bone development. Lack of the encoded protein also impairs the wound healing process due to reduced keratinocyte migration and vascular density at the wound site. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Jun 2015]
PHENOTYPE: Homozygous null mice display increased width of hypertrophic chondrocyte zone and increased trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,056 L170Q probably damaging Het
Aacs T A 5: 125,503,223 I204N possibly damaging Het
Acaca A G 11: 84,372,627 T2025A probably damaging Het
B4galt3 C T 1: 171,276,365 R170C probably benign Het
BC028528 T C 3: 95,891,959 probably null Het
Ccdc73 A T 2: 104,907,610 Q17L possibly damaging Het
Ccdc73 A G 2: 104,914,667 T50A possibly damaging Het
Ccdc83 T C 7: 90,259,469 D19G probably damaging Het
Cct8l1 T C 5: 25,517,769 V494A probably benign Het
Chd1 T C 17: 15,739,507 F663L probably damaging Het
Chn2 A T 6: 54,293,080 E319V probably damaging Het
Cnnm1 T C 19: 43,471,856 V679A probably damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Cyp3a11 G T 5: 145,858,771 L457I probably benign Het
Dera T A 6: 137,830,195 S214T possibly damaging Het
Dmtf1 A G 5: 9,121,404 V501A possibly damaging Het
Dnpep A G 1: 75,316,027 V114A probably damaging Het
Dscam C T 16: 96,790,910 V722M probably benign Het
Dsp A G 13: 38,181,138 N499S probably damaging Het
Ecd A T 14: 20,346,657 Y53* probably null Het
Esyt3 T C 9: 99,318,066 T692A probably benign Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fat1 T A 8: 45,025,622 N2545K probably damaging Het
Fndc3a A G 14: 72,557,632 probably null Het
Fscn3 A G 6: 28,430,568 M246V probably benign Het
Gde1 G T 7: 118,691,784 T106K probably benign Het
Gjc2 A G 11: 59,177,608 I16T possibly damaging Het
Hacd4 A T 4: 88,423,023 M168K probably damaging Het
Hmx3 A G 7: 131,544,097 E178G probably damaging Het
Htt A G 5: 34,803,827 Y266C probably damaging Het
Kif27 G T 13: 58,303,545 R990S probably damaging Het
Krtap22-2 A T 16: 89,010,646 Y21* probably null Het
Lrrc41 T A 4: 116,095,208 L661* probably null Het
Lrrc63 T C 14: 75,125,984 T236A probably benign Het
Myh8 T C 11: 67,292,725 I754T probably benign Het
Neb A C 2: 52,175,607 D5961E probably benign Het
Nlrx1 T C 9: 44,264,077 H134R probably benign Het
Npepps A T 11: 97,226,847 M542K probably benign Het
Nup160 C T 2: 90,679,399 probably benign Het
Olfr402 T A 11: 74,155,137 probably null Het
Olfr952 T A 9: 39,426,592 T160S possibly damaging Het
Pikfyve T C 1: 65,262,977 probably null Het
Ppp6r1 A T 7: 4,640,378 probably null Het
Prss33 A G 17: 23,835,098 W45R probably damaging Het
Ptprf A T 4: 118,212,105 Y980* probably null Het
Qrich1 T C 9: 108,559,332 V743A probably benign Het
Rev3l G A 10: 39,783,333 probably null Het
Samd9l A T 6: 3,376,369 N297K probably benign Het
Sap130 A G 18: 31,680,474 H528R possibly damaging Het
Slc9b2 T C 3: 135,326,102 V241A probably benign Het
Snx14 A T 9: 88,394,528 V577E probably benign Het
Srrm2 T C 17: 23,815,902 S507P probably benign Het
Stat2 A G 10: 128,282,100 probably null Het
Susd5 T C 9: 114,096,684 F545S probably benign Het
Tnnt2 A G 1: 135,848,026 T107A probably benign Het
Trappc6b T A 12: 59,048,167 I41F possibly damaging Het
Ttn T A 2: 76,852,073 probably benign Het
Vmn1r88 A C 7: 13,177,951 D78A probably damaging Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Xpc C T 6: 91,508,528 D122N possibly damaging Het
Xpo1 C T 11: 23,291,623 A890V probably damaging Het
Zfp493 A G 13: 67,786,561 H211R probably damaging Het
Zfp958 A T 8: 4,629,190 H405L probably damaging Het
Other mutations in Mmp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Mmp13 APN 9 7278974 splice site probably benign
IGL02027:Mmp13 APN 9 7272955 missense probably damaging 1.00
IGL02320:Mmp13 APN 9 7278941 missense probably benign 0.00
R0143:Mmp13 UTSW 9 7276558 missense probably damaging 1.00
R0417:Mmp13 UTSW 9 7276602 missense probably benign
R0505:Mmp13 UTSW 9 7272929 missense probably damaging 1.00
R0624:Mmp13 UTSW 9 7280221 missense possibly damaging 0.69
R0632:Mmp13 UTSW 9 7274032 missense probably damaging 1.00
R0632:Mmp13 UTSW 9 7282077 missense possibly damaging 0.74
R1102:Mmp13 UTSW 9 7272952 missense possibly damaging 0.55
R1387:Mmp13 UTSW 9 7282033 missense possibly damaging 0.60
R1669:Mmp13 UTSW 9 7277926 missense probably benign 0.01
R4647:Mmp13 UTSW 9 7274233 missense probably damaging 1.00
R4648:Mmp13 UTSW 9 7274233 missense probably damaging 1.00
R4668:Mmp13 UTSW 9 7272580 missense possibly damaging 0.54
R4827:Mmp13 UTSW 9 7278880 missense possibly damaging 0.68
R4898:Mmp13 UTSW 9 7272953 missense probably benign 0.10
R5780:Mmp13 UTSW 9 7278952 missense possibly damaging 0.76
R5946:Mmp13 UTSW 9 7276580 missense probably damaging 1.00
R5996:Mmp13 UTSW 9 7274269 missense probably damaging 1.00
R6102:Mmp13 UTSW 9 7276688 missense probably benign 0.07
R6693:Mmp13 UTSW 9 7280245 missense probably benign 0.00
R6789:Mmp13 UTSW 9 7272781 missense probably benign 0.00
T0722:Mmp13 UTSW 9 7280857 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GCAGAGGTACTGTATTCTGCCAAGG -3'
(R):5'- AGTGGAACCCTCCATCTTCAGGAAC -3'

Sequencing Primer
(F):5'- TATTCTGCCAAGGATGGCAC -3'
(R):5'- CTCACCAAAAATAATGTTGGGGC -3'
Posted On2014-03-28