Incidental Mutation 'R1478:Nlrx1'
ID165633
Institutional Source Beutler Lab
Gene Symbol Nlrx1
Ensembl Gene ENSMUSG00000032109
Gene NameNLR family member X1
Synonyms
MMRRC Submission 039531-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R1478 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44252717-44268599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44264077 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 134 (H134R)
Ref Sequence ENSEMBL: ENSMUSP00000149124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034621] [ENSMUST00000168499] [ENSMUST00000169651] [ENSMUST00000213803] [ENSMUST00000217465]
Predicted Effect probably benign
Transcript: ENSMUST00000034621
AA Change: H134R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034621
Gene: ENSMUSG00000032109
AA Change: H134R

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.1e-22 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168499
AA Change: H134R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127531
Gene: ENSMUSG00000032109
AA Change: H134R

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169651
AA Change: H134R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126555
Gene: ENSMUSG00000032109
AA Change: H134R

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213764
Predicted Effect probably benign
Transcript: ENSMUST00000213803
AA Change: H134R

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000217465
AA Change: H134R

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,056 L170Q probably damaging Het
Aacs T A 5: 125,503,223 I204N possibly damaging Het
Acaca A G 11: 84,372,627 T2025A probably damaging Het
B4galt3 C T 1: 171,276,365 R170C probably benign Het
BC028528 T C 3: 95,891,959 probably null Het
Ccdc73 A T 2: 104,907,610 Q17L possibly damaging Het
Ccdc73 A G 2: 104,914,667 T50A possibly damaging Het
Ccdc83 T C 7: 90,259,469 D19G probably damaging Het
Cct8l1 T C 5: 25,517,769 V494A probably benign Het
Chd1 T C 17: 15,739,507 F663L probably damaging Het
Chn2 A T 6: 54,293,080 E319V probably damaging Het
Cnnm1 T C 19: 43,471,856 V679A probably damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Cyp3a11 G T 5: 145,858,771 L457I probably benign Het
Dera T A 6: 137,830,195 S214T possibly damaging Het
Dmtf1 A G 5: 9,121,404 V501A possibly damaging Het
Dnpep A G 1: 75,316,027 V114A probably damaging Het
Dscam C T 16: 96,790,910 V722M probably benign Het
Dsp A G 13: 38,181,138 N499S probably damaging Het
Ecd A T 14: 20,346,657 Y53* probably null Het
Esyt3 T C 9: 99,318,066 T692A probably benign Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fat1 T A 8: 45,025,622 N2545K probably damaging Het
Fndc3a A G 14: 72,557,632 probably null Het
Fscn3 A G 6: 28,430,568 M246V probably benign Het
Gde1 G T 7: 118,691,784 T106K probably benign Het
Gjc2 A G 11: 59,177,608 I16T possibly damaging Het
Hacd4 A T 4: 88,423,023 M168K probably damaging Het
Hmx3 A G 7: 131,544,097 E178G probably damaging Het
Htt A G 5: 34,803,827 Y266C probably damaging Het
Kif27 G T 13: 58,303,545 R990S probably damaging Het
Krtap22-2 A T 16: 89,010,646 Y21* probably null Het
Lrrc41 T A 4: 116,095,208 L661* probably null Het
Lrrc63 T C 14: 75,125,984 T236A probably benign Het
Mmp13 T C 9: 7,272,892 L84P probably damaging Het
Myh8 T C 11: 67,292,725 I754T probably benign Het
Neb A C 2: 52,175,607 D5961E probably benign Het
Npepps A T 11: 97,226,847 M542K probably benign Het
Nup160 C T 2: 90,679,399 probably benign Het
Olfr402 T A 11: 74,155,137 probably null Het
Olfr952 T A 9: 39,426,592 T160S possibly damaging Het
Pikfyve T C 1: 65,262,977 probably null Het
Ppp6r1 A T 7: 4,640,378 probably null Het
Prss33 A G 17: 23,835,098 W45R probably damaging Het
Ptprf A T 4: 118,212,105 Y980* probably null Het
Qrich1 T C 9: 108,559,332 V743A probably benign Het
Rev3l G A 10: 39,783,333 probably null Het
Samd9l A T 6: 3,376,369 N297K probably benign Het
Sap130 A G 18: 31,680,474 H528R possibly damaging Het
Slc9b2 T C 3: 135,326,102 V241A probably benign Het
Snx14 A T 9: 88,394,528 V577E probably benign Het
Srrm2 T C 17: 23,815,902 S507P probably benign Het
Stat2 A G 10: 128,282,100 probably null Het
Susd5 T C 9: 114,096,684 F545S probably benign Het
Tnnt2 A G 1: 135,848,026 T107A probably benign Het
Trappc6b T A 12: 59,048,167 I41F possibly damaging Het
Ttn T A 2: 76,852,073 probably benign Het
Vmn1r88 A C 7: 13,177,951 D78A probably damaging Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Xpc C T 6: 91,508,528 D122N possibly damaging Het
Xpo1 C T 11: 23,291,623 A890V probably damaging Het
Zfp493 A G 13: 67,786,561 H211R probably damaging Het
Zfp958 A T 8: 4,629,190 H405L probably damaging Het
Other mutations in Nlrx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nlrx1 APN 9 44253279 missense probably damaging 0.96
IGL00233:Nlrx1 APN 9 44264068 missense probably benign 0.37
IGL02388:Nlrx1 APN 9 44264005 missense probably benign 0.09
IGL02450:Nlrx1 APN 9 44253501 missense probably benign
IGL03353:Nlrx1 APN 9 44256593 missense probably benign
R0180:Nlrx1 UTSW 9 44255459 missense possibly damaging 0.95
R0416:Nlrx1 UTSW 9 44262914 missense probably benign
R1762:Nlrx1 UTSW 9 44263640 missense possibly damaging 0.49
R1921:Nlrx1 UTSW 9 44254134 nonsense probably null
R1972:Nlrx1 UTSW 9 44253456 missense probably benign 0.01
R2050:Nlrx1 UTSW 9 44262780 missense probably damaging 1.00
R2100:Nlrx1 UTSW 9 44262608 missense probably damaging 1.00
R3967:Nlrx1 UTSW 9 44255425 splice site probably benign
R3968:Nlrx1 UTSW 9 44255425 splice site probably benign
R3969:Nlrx1 UTSW 9 44255425 splice site probably benign
R4898:Nlrx1 UTSW 9 44256897 missense probably benign
R4951:Nlrx1 UTSW 9 44253429 missense possibly damaging 0.81
R4956:Nlrx1 UTSW 9 44262612 nonsense probably null
R4959:Nlrx1 UTSW 9 44254151 missense possibly damaging 0.79
R5235:Nlrx1 UTSW 9 44263750 missense probably damaging 0.99
R5536:Nlrx1 UTSW 9 44263886 missense probably damaging 1.00
R6030:Nlrx1 UTSW 9 44263760 missense probably damaging 1.00
R6030:Nlrx1 UTSW 9 44263760 missense probably damaging 1.00
R6698:Nlrx1 UTSW 9 44265807 missense probably damaging 1.00
R7130:Nlrx1 UTSW 9 44262341 missense possibly damaging 0.83
R7253:Nlrx1 UTSW 9 44264704 splice site probably null
R7457:Nlrx1 UTSW 9 44256510 missense probably benign 0.28
X0023:Nlrx1 UTSW 9 44256563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAGGGGCAACACCTCTTTCAG -3'
(R):5'- TATCCAAAGGCATCGCCGGAAC -3'

Sequencing Primer
(F):5'- TAACGCTGGGTCACAAGTTG -3'
(R):5'- AACCTCACCGAGTGGTTTAG -3'
Posted On2014-03-28