Incidental Mutation 'R1478:Susd5'
ID165637
Institutional Source Beutler Lab
Gene Symbol Susd5
Ensembl Gene ENSMUSG00000086596
Gene Namesushi domain containing 5
SynonymsLOC382111
MMRRC Submission 039531-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1478 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location114057140-114098728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114096684 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 545 (F545S)
Ref Sequence ENSEMBL: ENSMUSP00000128826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135338]
Predicted Effect probably benign
Transcript: ENSMUST00000135338
AA Change: F545S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128826
Gene: ENSMUSG00000086596
AA Change: F545S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LINK 33 130 7.42e-26 SMART
CCP 136 193 9.65e-1 SMART
low complexity region 416 428 N/A INTRINSIC
low complexity region 485 496 N/A INTRINSIC
transmembrane domain 566 588 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,056 L170Q probably damaging Het
Aacs T A 5: 125,503,223 I204N possibly damaging Het
Acaca A G 11: 84,372,627 T2025A probably damaging Het
B4galt3 C T 1: 171,276,365 R170C probably benign Het
BC028528 T C 3: 95,891,959 probably null Het
Ccdc73 A T 2: 104,907,610 Q17L possibly damaging Het
Ccdc73 A G 2: 104,914,667 T50A possibly damaging Het
Ccdc83 T C 7: 90,259,469 D19G probably damaging Het
Cct8l1 T C 5: 25,517,769 V494A probably benign Het
Chd1 T C 17: 15,739,507 F663L probably damaging Het
Chn2 A T 6: 54,293,080 E319V probably damaging Het
Cnnm1 T C 19: 43,471,856 V679A probably damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Cyp3a11 G T 5: 145,858,771 L457I probably benign Het
Dera T A 6: 137,830,195 S214T possibly damaging Het
Dmtf1 A G 5: 9,121,404 V501A possibly damaging Het
Dnpep A G 1: 75,316,027 V114A probably damaging Het
Dscam C T 16: 96,790,910 V722M probably benign Het
Dsp A G 13: 38,181,138 N499S probably damaging Het
Ecd A T 14: 20,346,657 Y53* probably null Het
Esyt3 T C 9: 99,318,066 T692A probably benign Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fat1 T A 8: 45,025,622 N2545K probably damaging Het
Fndc3a A G 14: 72,557,632 probably null Het
Fscn3 A G 6: 28,430,568 M246V probably benign Het
Gde1 G T 7: 118,691,784 T106K probably benign Het
Gjc2 A G 11: 59,177,608 I16T possibly damaging Het
Hacd4 A T 4: 88,423,023 M168K probably damaging Het
Hmx3 A G 7: 131,544,097 E178G probably damaging Het
Htt A G 5: 34,803,827 Y266C probably damaging Het
Kif27 G T 13: 58,303,545 R990S probably damaging Het
Krtap22-2 A T 16: 89,010,646 Y21* probably null Het
Lrrc41 T A 4: 116,095,208 L661* probably null Het
Lrrc63 T C 14: 75,125,984 T236A probably benign Het
Mmp13 T C 9: 7,272,892 L84P probably damaging Het
Myh8 T C 11: 67,292,725 I754T probably benign Het
Neb A C 2: 52,175,607 D5961E probably benign Het
Nlrx1 T C 9: 44,264,077 H134R probably benign Het
Npepps A T 11: 97,226,847 M542K probably benign Het
Nup160 C T 2: 90,679,399 probably benign Het
Olfr402 T A 11: 74,155,137 probably null Het
Olfr952 T A 9: 39,426,592 T160S possibly damaging Het
Pikfyve T C 1: 65,262,977 probably null Het
Ppp6r1 A T 7: 4,640,378 probably null Het
Prss33 A G 17: 23,835,098 W45R probably damaging Het
Ptprf A T 4: 118,212,105 Y980* probably null Het
Qrich1 T C 9: 108,559,332 V743A probably benign Het
Rev3l G A 10: 39,783,333 probably null Het
Samd9l A T 6: 3,376,369 N297K probably benign Het
Sap130 A G 18: 31,680,474 H528R possibly damaging Het
Slc9b2 T C 3: 135,326,102 V241A probably benign Het
Snx14 A T 9: 88,394,528 V577E probably benign Het
Srrm2 T C 17: 23,815,902 S507P probably benign Het
Stat2 A G 10: 128,282,100 probably null Het
Tnnt2 A G 1: 135,848,026 T107A probably benign Het
Trappc6b T A 12: 59,048,167 I41F possibly damaging Het
Ttn T A 2: 76,852,073 probably benign Het
Vmn1r88 A C 7: 13,177,951 D78A probably damaging Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Xpc C T 6: 91,508,528 D122N possibly damaging Het
Xpo1 C T 11: 23,291,623 A890V probably damaging Het
Zfp493 A G 13: 67,786,561 H211R probably damaging Het
Zfp958 A T 8: 4,629,190 H405L probably damaging Het
Other mutations in Susd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Susd5 APN 9 114068879 splice site probably benign
IGL01720:Susd5 APN 9 114063984 missense possibly damaging 0.85
IGL02739:Susd5 APN 9 114096033 missense possibly damaging 0.72
H8441:Susd5 UTSW 9 114096185 nonsense probably null
R0238:Susd5 UTSW 9 114096909 makesense probably null
R0238:Susd5 UTSW 9 114096909 makesense probably null
R0650:Susd5 UTSW 9 114082535 missense possibly damaging 0.53
R0666:Susd5 UTSW 9 114095784 missense possibly damaging 0.53
R1672:Susd5 UTSW 9 114068822 missense probably damaging 0.99
R3416:Susd5 UTSW 9 114095658 missense possibly damaging 0.85
R3965:Susd5 UTSW 9 114096192 missense possibly damaging 0.72
R4182:Susd5 UTSW 9 114095985 missense probably benign 0.12
R4514:Susd5 UTSW 9 114095924 missense probably benign 0.18
R5373:Susd5 UTSW 9 114082585 missense probably damaging 1.00
R5947:Susd5 UTSW 9 114057591 missense possibly damaging 0.96
R6189:Susd5 UTSW 9 114095658 missense probably damaging 0.98
R6349:Susd5 UTSW 9 114095802 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCAGTCCATCTCAAATGCTCGACG -3'
(R):5'- TGCTGATAGAGGCTACACCTTCTCC -3'

Sequencing Primer
(F):5'- AGGACCCATCAATGTGTCTG -3'
(R):5'- GTAGTGTCTAGCCTGCCG -3'
Posted On2014-03-28