Incidental Mutation 'R1473:Igsf10'
ID165900
Institutional Source Beutler Lab
Gene Symbol Igsf10
Ensembl Gene ENSMUSG00000036334
Gene Nameimmunoglobulin superfamily, member 10
SynonymsAdlican2, CMF608, 6530405F15Rik
MMRRC Submission 039526-MU
Accession Numbers

Genbank: NM_001162884; MGI: 1923481

Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R1473 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59316735-59344394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59318767 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 2495 (V2495E)
Ref Sequence ENSEMBL: ENSMUSP00000141391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000040325] [ENSMUST00000164225] [ENSMUST00000193455] [ENSMUST00000194546] [ENSMUST00000199659]
Predicted Effect probably damaging
Transcript: ENSMUST00000039419
AA Change: V2495E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: V2495E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193455
AA Change: V2495E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: V2495E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194546
AA Change: V2495E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: V2495E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197374
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,068,236 D342G probably damaging Het
Acad8 T C 9: 26,979,041 T293A probably benign Het
Adamts13 C A 2: 26,981,753 Y310* probably null Het
Adcy6 T A 15: 98,592,743 Y1102F probably damaging Het
Ahctf1 G A 1: 179,776,108 T791M probably benign Het
Ahctf1 A G 1: 179,799,279 V18A probably damaging Het
Ampd3 T G 7: 110,804,935 S564R probably damaging Het
Anapc1 A T 2: 128,617,697 I1814K possibly damaging Het
Arl4c A T 1: 88,701,609 L19Q probably damaging Het
Atp6v0e2 T C 6: 48,539,264 Y49H probably damaging Het
Ccdc24 G T 4: 117,869,904 probably benign Het
Clcn6 A C 4: 148,024,156 F139V possibly damaging Het
Col2a1 A G 15: 97,982,908 probably benign Het
Crip2 T A 12: 113,143,500 C29S probably damaging Het
Cyp2a4 A C 7: 26,314,763 N455T probably benign Het
Dhcr7 A G 7: 143,841,368 D113G probably damaging Het
Dhcr7 T C 7: 143,847,068 Y323H probably damaging Het
Dnah7a A C 1: 53,496,014 S2696A probably benign Het
Dnajc12 A G 10: 63,397,244 T55A probably benign Het
Drosha G A 15: 12,912,520 E1075K probably benign Het
Duox2 A G 2: 122,287,121 S911P possibly damaging Het
Ephb2 G A 4: 136,694,058 A327V possibly damaging Het
Espl1 C T 15: 102,320,443 T1711I possibly damaging Het
Fmnl2 A G 2: 52,858,207 K22R possibly damaging Het
Fzd6 T C 15: 39,030,963 F175L probably damaging Het
Gm4737 T A 16: 46,154,819 E65V probably damaging Het
Gm5155 A G 7: 17,905,091 noncoding transcript Het
Gm6526 A G 14: 43,748,846 I76M probably damaging Het
Gm6583 T C 5: 112,354,549 T430A probably benign Het
Gm9881 A T 16: 91,170,735 F34I unknown Het
Gm9892 T C 8: 52,196,614 D148G possibly damaging Het
Grb10 C T 11: 11,934,249 V486I probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdac4 T C 1: 92,029,968 H108R possibly damaging Het
Hist2h2bb G T 3: 96,270,072 L107F probably damaging Het
Hmcn1 G A 1: 150,772,552 T661I probably benign Het
Icam1 T A 9: 21,027,876 I515N probably damaging Het
Ifi208 A G 1: 173,695,654 R497G possibly damaging Het
Iqgap1 T C 7: 80,734,011 M1102V probably benign Het
Itgb4 A T 11: 115,984,047 N410I probably benign Het
Jup T C 11: 100,379,601 H360R possibly damaging Het
Kif20b T A 19: 34,974,496 S1685T possibly damaging Het
Lins1 T C 7: 66,712,046 probably null Het
Lrig1 T A 6: 94,607,313 T917S probably benign Het
Mast2 A G 4: 116,311,955 S814P probably damaging Het
Mast4 T C 13: 102,772,519 T483A probably damaging Het
Mcpt1 T C 14: 56,019,533 M176T probably benign Het
Mettl22 A G 16: 8,473,961 Q38R probably damaging Het
Mrm2 T C 5: 140,328,688 T131A probably benign Het
Nde1 T G 16: 14,185,864 F71V probably benign Het
Nxn C T 11: 76,263,187 G274D possibly damaging Het
Olfr1230 A T 2: 89,296,906 Y121* probably null Het
Olfr183 A T 16: 58,999,912 T76S probably benign Het
Olfr414 T A 1: 174,430,643 W72R probably damaging Het
Olfr427 G T 1: 174,099,749 C97F probably damaging Het
Osbp2 T C 11: 3,717,175 probably null Het
Otud7a C A 7: 63,754,629 probably benign Het
Phf3 G A 1: 30,805,940 L1313F probably damaging Het
Pkhd1 A T 1: 20,522,983 D1635E probably benign Het
Plpp1 A G 13: 112,859,664 H171R probably damaging Het
Pofut1 A G 2: 153,261,246 M172V probably damaging Het
Prmt5 A G 14: 54,508,915 F580L probably damaging Het
Rab11fip3 A T 17: 25,991,322 L987Q probably damaging Het
Retnlb T A 16: 48,818,665 C76* probably null Het
Rnf38 T C 4: 44,131,584 N399S probably benign Het
Sbk1 A G 7: 126,292,252 E286G possibly damaging Het
Scin T A 12: 40,077,502 T430S probably benign Het
Sgsm1 T A 5: 113,263,257 T868S probably benign Het
Sipa1l1 G A 12: 82,341,111 R37H probably damaging Het
Smchd1 A T 17: 71,361,837 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Soga1 A T 2: 157,020,448 Y1520* probably null Het
Stk32c C T 7: 139,125,179 R23Q probably damaging Het
Sult1d1 A G 5: 87,564,739 M82T probably benign Het
Tat T C 8: 109,996,918 L346P probably damaging Het
Tenm3 C A 8: 48,310,625 G789V probably damaging Het
Thsd7a C T 6: 12,338,622 S1203N probably benign Het
Tmem191c G A 16: 17,277,962 probably null Het
Tmem268 A G 4: 63,580,338 T239A probably damaging Het
Tmem82 A C 4: 141,616,278 L227R possibly damaging Het
Ttn A T 2: 76,727,032 I29906N probably damaging Het
Txndc15 T C 13: 55,721,574 probably benign Het
Ubqln4 A G 3: 88,565,845 I536V probably benign Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r102 A T 17: 19,694,581 I803F probably benign Het
Vmn2r6 G T 3: 64,538,158 Y715* probably null Het
Vmn2r74 A T 7: 85,961,410 C25S probably damaging Het
Wdr38 A G 2: 39,000,979 T261A probably benign Het
Zfp653 T C 9: 22,058,220 E250G possibly damaging Het
Other mutations in Igsf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Igsf10 APN 3 59331539 missense probably benign 0.03
IGL00790:Igsf10 APN 3 59319517 missense probably damaging 1.00
IGL00916:Igsf10 APN 3 59331127 missense probably damaging 0.97
IGL00928:Igsf10 APN 3 59330597 missense probably benign 0.00
IGL01066:Igsf10 APN 3 59327782 critical splice donor site probably null
IGL01107:Igsf10 APN 3 59331524 missense probably damaging 1.00
IGL01420:Igsf10 APN 3 59319650 missense probably benign 0.02
IGL01533:Igsf10 APN 3 59319230 missense probably damaging 0.98
IGL01537:Igsf10 APN 3 59330031 missense probably benign 0.00
IGL01676:Igsf10 APN 3 59326011 missense probably benign 0.06
IGL01676:Igsf10 APN 3 59329335 missense probably benign 0.17
IGL01960:Igsf10 APN 3 59318737 missense probably benign 0.00
IGL02123:Igsf10 APN 3 59318660 missense probably damaging 0.97
IGL02198:Igsf10 APN 3 59325978 missense possibly damaging 0.95
IGL02268:Igsf10 APN 3 59331152 nonsense probably null
IGL02313:Igsf10 APN 3 59330690 missense probably benign 0.01
IGL02368:Igsf10 APN 3 59328231 missense probably benign
IGL02494:Igsf10 APN 3 59328006 missense probably damaging 0.98
IGL02549:Igsf10 APN 3 59329241 missense probably benign 0.03
IGL02616:Igsf10 APN 3 59318606 missense probably benign 0.06
IGL02957:Igsf10 APN 3 59330864 missense probably damaging 1.00
IGL03067:Igsf10 APN 3 59318918 missense probably benign 0.25
IGL03104:Igsf10 APN 3 59319484 missense probably damaging 1.00
IGL03124:Igsf10 APN 3 59319665 missense probably benign 0.01
IGL03212:Igsf10 APN 3 59328165 missense probably benign 0.09
IGL03347:Igsf10 APN 3 59331900 missense possibly damaging 0.94
IGL03357:Igsf10 APN 3 59336211 missense probably benign 0.35
F6893:Igsf10 UTSW 3 59331060 missense probably damaging 1.00
FR4449:Igsf10 UTSW 3 59319110 missense probably damaging 1.00
PIT1430001:Igsf10 UTSW 3 59328158 missense probably benign 0.06
R0068:Igsf10 UTSW 3 59330624 missense probably damaging 0.98
R0095:Igsf10 UTSW 3 59331196 nonsense probably null
R0095:Igsf10 UTSW 3 59331196 nonsense probably null
R0112:Igsf10 UTSW 3 59326008 missense probably benign 0.00
R0141:Igsf10 UTSW 3 59330832 missense probably damaging 1.00
R0538:Igsf10 UTSW 3 59320106 missense probably damaging 0.99
R0551:Igsf10 UTSW 3 59328668 missense probably benign 0.01
R0556:Igsf10 UTSW 3 59328875 missense probably benign 0.02
R0582:Igsf10 UTSW 3 59319767 missense probably benign 0.00
R0630:Igsf10 UTSW 3 59326062 missense probably damaging 1.00
R0675:Igsf10 UTSW 3 59328594 missense probably benign 0.14
R0948:Igsf10 UTSW 3 59331104 missense probably damaging 1.00
R1252:Igsf10 UTSW 3 59331848 missense probably benign 0.03
R1412:Igsf10 UTSW 3 59327775 splice site probably benign
R1585:Igsf10 UTSW 3 59330417 missense probably damaging 1.00
R1650:Igsf10 UTSW 3 59326162 missense probably damaging 1.00
R1660:Igsf10 UTSW 3 59331285 missense probably damaging 1.00
R1671:Igsf10 UTSW 3 59328500 nonsense probably null
R1748:Igsf10 UTSW 3 59319093 missense probably damaging 1.00
R1758:Igsf10 UTSW 3 59329196 missense probably benign 0.09
R1856:Igsf10 UTSW 3 59331272 missense possibly damaging 0.63
R1912:Igsf10 UTSW 3 59329572 missense probably benign 0.40
R2148:Igsf10 UTSW 3 59336577 missense possibly damaging 0.77
R2155:Igsf10 UTSW 3 59331680 missense probably damaging 1.00
R2509:Igsf10 UTSW 3 59331866 missense probably damaging 1.00
R2511:Igsf10 UTSW 3 59331866 missense probably damaging 1.00
R2680:Igsf10 UTSW 3 59325454 missense probably benign 0.14
R2913:Igsf10 UTSW 3 59331736 missense possibly damaging 0.70
R2927:Igsf10 UTSW 3 59329427 missense probably benign
R3547:Igsf10 UTSW 3 59330541 missense probably benign 0.02
R3547:Igsf10 UTSW 3 59336514 missense probably damaging 1.00
R3548:Igsf10 UTSW 3 59336514 missense probably damaging 1.00
R3620:Igsf10 UTSW 3 59336331 missense probably damaging 1.00
R3732:Igsf10 UTSW 3 59325714 missense probably benign 0.29
R3743:Igsf10 UTSW 3 59326125 missense possibly damaging 0.69
R3973:Igsf10 UTSW 3 59331924 missense probably damaging 1.00
R4005:Igsf10 UTSW 3 59328560 missense probably benign 0.00
R4184:Igsf10 UTSW 3 59319731 missense probably damaging 1.00
R4302:Igsf10 UTSW 3 59318750 missense probably damaging 1.00
R4404:Igsf10 UTSW 3 59329551 missense probably benign 0.04
R4575:Igsf10 UTSW 3 59330100 missense probably benign
R4676:Igsf10 UTSW 3 59325949 missense probably benign 0.23
R4700:Igsf10 UTSW 3 59320330 missense probably damaging 0.99
R4765:Igsf10 UTSW 3 59329705 missense probably benign 0.01
R4986:Igsf10 UTSW 3 59328606 missense probably benign 0.24
R5012:Igsf10 UTSW 3 59318722 missense probably damaging 1.00
R5070:Igsf10 UTSW 3 59328293 missense probably benign 0.02
R5083:Igsf10 UTSW 3 59326273 missense probably damaging 1.00
R5336:Igsf10 UTSW 3 59320132 missense probably damaging 1.00
R5462:Igsf10 UTSW 3 59325754 missense probably damaging 1.00
R5648:Igsf10 UTSW 3 59328153 missense probably benign 0.01
R5810:Igsf10 UTSW 3 59319071 missense probably damaging 1.00
R5871:Igsf10 UTSW 3 59330411 missense possibly damaging 0.83
R5880:Igsf10 UTSW 3 59330831 missense probably damaging 1.00
R5935:Igsf10 UTSW 3 59328157 missense probably benign 0.12
R5979:Igsf10 UTSW 3 59336473 missense probably damaging 1.00
R6145:Igsf10 UTSW 3 59331656 missense possibly damaging 0.83
R6222:Igsf10 UTSW 3 59318915 missense possibly damaging 0.90
R6224:Igsf10 UTSW 3 59325510 missense probably damaging 1.00
R6264:Igsf10 UTSW 3 59328507 missense possibly damaging 0.88
R6283:Igsf10 UTSW 3 59319449 missense probably damaging 1.00
R6336:Igsf10 UTSW 3 59330339 missense probably benign 0.00
R6490:Igsf10 UTSW 3 59329571 missense probably benign 0.06
R6785:Igsf10 UTSW 3 59319244 missense probably damaging 1.00
R6873:Igsf10 UTSW 3 59328444 missense probably benign
R6889:Igsf10 UTSW 3 59331933 missense probably benign
Z1088:Igsf10 UTSW 3 59329938 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GCTCGTAGATTCTGAATGACCAGCG -3'
(R):5'- GTGTGTCTGATGGAATCCCTAAGCC -3'

Sequencing Primer
(F):5'- TGAATGACCAGCGTACCTTG -3'
(R):5'- TGTCAAATGGACTACGCCAG -3'
Posted On2014-03-28