Incidental Mutation 'R1392:Olfr351'
ID165968
Institutional Source Beutler Lab
Gene Symbol Olfr351
Ensembl Gene ENSMUSG00000075383
Gene Nameolfactory receptor 351
SynonymsMOR127-2, GA_x6K02T2NLDC-33554926-33553994
MMRRC Submission 039454-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1392 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36857539-36862660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36860175 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 58 (Y58N)
Ref Sequence ENSEMBL: ENSMUSP00000150346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100150] [ENSMUST00000213676] [ENSMUST00000215137]
Predicted Effect probably damaging
Transcript: ENSMUST00000100150
AA Change: Y58N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097727
Gene: ENSMUSG00000075383
AA Change: Y58N

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.7e-56 PFAM
Pfam:7tm_1 39 288 5.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213676
AA Change: Y58N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215137
AA Change: Y58N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.6%
  • 10x: 94.0%
  • 20x: 82.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Csf1 A G 3: 107,756,630 V74A probably benign Het
Hnrnpm A T 17: 33,658,415 S325T possibly damaging Het
Hunk T C 16: 90,472,464 S299P probably damaging Het
Kcnk4 C T 19: 6,927,663 V207I possibly damaging Het
Mettl7b T C 10: 128,960,698 T81A possibly damaging Het
Myo15 A G 11: 60,477,974 H520R possibly damaging Het
Olfr310 A T 7: 86,268,855 F311L probably benign Het
Phc2 A G 4: 128,745,087 H607R possibly damaging Het
Rsad2 A G 12: 26,445,440 V352A probably benign Het
Rtn4rl2 A G 2: 84,880,512 L136P probably damaging Het
Spef2 C T 15: 9,647,263 V993I probably benign Het
Tiam2 A G 17: 3,414,197 H67R possibly damaging Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Tmem246 A G 4: 49,586,919 L83P probably damaging Het
Vmn2r65 A T 7: 84,947,416 S144T probably benign Het
Vmn2r77 A G 7: 86,801,622 T239A probably benign Het
Other mutations in Olfr351
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Olfr351 APN 2 36859775 missense probably benign 0.04
IGL02481:Olfr351 APN 2 36859818 missense probably damaging 0.96
IGL02673:Olfr351 APN 2 36860176 missense probably benign 0.25
IGL02754:Olfr351 APN 2 36860220 missense probably damaging 1.00
P0041:Olfr351 UTSW 2 36859461 missense probably damaging 1.00
R1392:Olfr351 UTSW 2 36860175 missense probably damaging 1.00
R2271:Olfr351 UTSW 2 36859625 missense probably damaging 1.00
R2274:Olfr351 UTSW 2 36860101 missense probably damaging 0.99
R3053:Olfr351 UTSW 2 36859947 missense probably benign 0.06
R4712:Olfr351 UTSW 2 36860369 splice site probably null
R5001:Olfr351 UTSW 2 36860070 missense probably benign 0.00
R5364:Olfr351 UTSW 2 36859994 missense probably damaging 1.00
R5502:Olfr351 UTSW 2 36860270 missense probably damaging 0.98
R6048:Olfr351 UTSW 2 36859841 missense probably benign 0.00
R6401:Olfr351 UTSW 2 36860165 nonsense probably null
R7353:Olfr351 UTSW 2 36859668 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGGAAGCTGTCCAGATCACCAAAC -3'
(R):5'- GTATGTTGAAGGCTCAGAGGCCAG -3'

Sequencing Primer
(F):5'- TGTCCAGATCACCAAACATCAG -3'
(R):5'- GCTCTATACTCATGGAGAATGAGTCC -3'
Posted On2014-03-28