Incidental Mutation 'R1466:Dido1'
ID166010
Institutional Source Beutler Lab
Gene Symbol Dido1
Ensembl Gene ENSMUSG00000038914
Gene Namedeath inducer-obliterator 1
Synonyms6720461J16Rik, DIO-1, Datf1, D130048F08Rik
Accession Numbers

Genbank: NM_175551; MGI: 1344352

Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R1466 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location180657964-180709999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 180662328 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1261 (P1261L)
Ref Sequence ENSEMBL: ENSMUSP00000084794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087517]
Predicted Effect probably damaging
Transcript: ENSMUST00000087517
AA Change: P1261L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: P1261L

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 1e-22 PFAM
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1279 1308 N/A INTRINSIC
low complexity region 1372 1391 N/A INTRINSIC
coiled coil region 1458 1502 N/A INTRINSIC
low complexity region 1649 1680 N/A INTRINSIC
low complexity region 1748 1766 N/A INTRINSIC
low complexity region 1780 1792 N/A INTRINSIC
low complexity region 1804 1815 N/A INTRINSIC
internal_repeat_2 1816 1852 3.9e-5 PROSPERO
internal_repeat_1 1819 1859 6.92e-7 PROSPERO
internal_repeat_2 1926 1964 3.9e-5 PROSPERO
internal_repeat_1 1940 1982 6.92e-7 PROSPERO
low complexity region 2025 2045 N/A INTRINSIC
low complexity region 2123 2160 N/A INTRINSIC
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2182 2239 N/A INTRINSIC
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
Adamts12 T C 15: 11,311,359 F1234S probably benign Het
Ahnak A G 19: 9,015,875 D4841G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arhgef17 G T 7: 100,929,659 P694Q possibly damaging Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
Aspg A G 12: 112,121,852 N385D probably benign Het
Atxn3 G A 12: 101,926,499 R319C possibly damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
C1s1 C T 6: 124,531,131 C633Y probably damaging Het
C8g C T 2: 25,500,216 A6T probably benign Het
Cbl A T 9: 44,154,244 V706E probably benign Het
Cfhr1 C T 1: 139,557,574 E45K probably benign Het
Chd7 G A 4: 8,840,561 probably null Het
Chek1 G T 9: 36,725,857 A2E probably damaging Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Corin C T 5: 72,302,790 probably null Het
Crb2 T C 2: 37,783,388 Y99H probably damaging Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Cym G A 3: 107,213,458 T277I probably damaging Het
Cyp2d11 C T 15: 82,391,735 C215Y probably benign Het
Dnah10 T A 5: 124,763,096 Y1265N probably benign Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Efhb A G 17: 53,437,178 F462L probably damaging Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Fat3 A C 9: 16,375,482 V915G probably damaging Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Galnt4 A G 10: 99,108,709 R99G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm10110 A T 14: 89,898,075 noncoding transcript Het
Gm4884 A G 7: 41,043,128 K174E probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grip2 A T 6: 91,788,443 D19E probably damaging Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T A 8: 110,532,953 V2519E possibly damaging Het
Ints11 G A 4: 155,888,110 probably null Het
Kif1a A G 1: 93,054,929 W718R possibly damaging Het
Kif1b A T 4: 149,223,252 Y839N probably damaging Het
Kif20b T A 19: 34,950,599 V1047D probably benign Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Klra10 T A 6: 130,279,315 R125S probably damaging Het
Klra10 T C 6: 130,279,431 N87D probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Map4k2 G T 19: 6,341,917 W87L probably damaging Het
Mccc1 A G 3: 35,974,286 V457A probably benign Het
Mdn1 T A 4: 32,730,788 S2886T probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrpl24 T A 3: 87,921,928 Y21* probably null Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Mtcl1 T A 17: 66,380,435 D492V probably damaging Het
Muc2 A G 7: 141,748,974 Y457C probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Myg1 T A 15: 102,337,390 L275Q probably damaging Het
Naga T A 15: 82,334,788 M237L probably null Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr103 A T 17: 37,336,956 L92H probably benign Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr46 A G 7: 140,610,969 I268V probably benign Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pcdh10 T G 3: 45,379,974 L241R probably damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Ppef1 C A X: 160,625,674 probably null Het
Prkaa1 C A 15: 5,178,798 P507T probably benign Het
Ptch1 A G 13: 63,524,969 Y804H probably benign Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rfx5 T A 3: 94,956,303 Y88N probably damaging Het
Rnase2b A T 14: 51,162,839 K126* probably null Het
Rpl3l A G 17: 24,730,871 I15V probably benign Het
Saal1 G T 7: 46,702,545 probably null Het
Sbpl A C 17: 23,953,254 D230E unknown Het
Scn10a T C 9: 119,666,490 Y322C probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc25a36 A G 9: 97,080,355 F194L probably damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc7a11 G T 3: 50,381,073 probably null Het
Slco4c1 A T 1: 96,841,172 S322T probably damaging Het
Smarcc2 A T 10: 128,474,245 T376S probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Syp A T X: 7,648,705 probably benign Het
Tas1r2 A G 4: 139,669,411 D687G probably damaging Het
Tekt4 A T 17: 25,472,074 Q118L probably benign Het
Tph2 T C 10: 115,079,695 N480S probably benign Het
Tsc2 A T 17: 24,608,973 M839K probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Uaca C T 9: 60,854,321 A205V possibly damaging Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Zfp704 G T 3: 9,447,348 T288N possibly damaging Het
Zfp93 T C 7: 24,276,096 V502A probably damaging Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Dido1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dido1 APN 2 180683989 missense probably benign
IGL00834:Dido1 APN 2 180689526 missense possibly damaging 0.80
IGL01317:Dido1 APN 2 180671757 missense probably benign 0.17
IGL01588:Dido1 APN 2 180688875 missense probably benign 0.00
IGL01834:Dido1 APN 2 180684031 splice site probably benign
IGL02102:Dido1 APN 2 180662247 missense possibly damaging 0.58
IGL02556:Dido1 APN 2 180689335 missense possibly damaging 0.69
IGL02756:Dido1 APN 2 180661923 missense probably benign 0.00
IGL02826:Dido1 APN 2 180683958 missense probably benign
IGL02970:Dido1 APN 2 180689415 missense probably damaging 0.99
IGL03110:Dido1 APN 2 180689342 missense probably damaging 1.00
IGL03116:Dido1 APN 2 180670979 missense probably damaging 1.00
3370:Dido1 UTSW 2 180671542 missense probably benign
A4554:Dido1 UTSW 2 180675371 missense probably damaging 1.00
H8441:Dido1 UTSW 2 180689014 missense probably benign 0.12
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0127:Dido1 UTSW 2 180671824 missense probably benign 0.01
R0620:Dido1 UTSW 2 180659851 missense probably benign 0.26
R0734:Dido1 UTSW 2 180660042 missense probably benign 0.01
R1390:Dido1 UTSW 2 180685124 missense possibly damaging 0.70
R1445:Dido1 UTSW 2 180671470 missense possibly damaging 0.62
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1472:Dido1 UTSW 2 180660720 missense probably benign 0.02
R1538:Dido1 UTSW 2 180684970 missense possibly damaging 0.49
R1584:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R2020:Dido1 UTSW 2 180659585 missense unknown
R2025:Dido1 UTSW 2 180689181 nonsense probably null
R2026:Dido1 UTSW 2 180689181 nonsense probably null
R2027:Dido1 UTSW 2 180689181 nonsense probably null
R2089:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2495:Dido1 UTSW 2 180689388 missense probably benign 0.00
R2931:Dido1 UTSW 2 180661653 missense probably damaging 1.00
R3418:Dido1 UTSW 2 180660935 missense possibly damaging 0.84
R3735:Dido1 UTSW 2 180684036 splice site probably benign
R4523:Dido1 UTSW 2 180672292 missense probably damaging 1.00
R4674:Dido1 UTSW 2 180687559 missense probably damaging 0.97
R4729:Dido1 UTSW 2 180687650 missense probably benign 0.00
R4762:Dido1 UTSW 2 180689575 missense probably damaging 1.00
R4786:Dido1 UTSW 2 180670871 missense possibly damaging 0.85
R4817:Dido1 UTSW 2 180661416 missense probably benign 0.02
R4892:Dido1 UTSW 2 180675029 nonsense probably null
R4979:Dido1 UTSW 2 180660813 missense probably damaging 0.98
R5510:Dido1 UTSW 2 180685173 missense probably benign 0.00
R5586:Dido1 UTSW 2 180659652 nonsense probably null
R5672:Dido1 UTSW 2 180671903 missense probably damaging 0.99
R5863:Dido1 UTSW 2 180661773 missense probably benign 0.02
R5943:Dido1 UTSW 2 180661882 missense probably benign 0.00
R5974:Dido1 UTSW 2 180671497 missense probably benign 0.02
R6123:Dido1 UTSW 2 180683967 missense probably benign 0.07
R6214:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6215:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6248:Dido1 UTSW 2 180660255 missense probably damaging 1.00
R6285:Dido1 UTSW 2 180661147 missense probably benign 0.00
R6349:Dido1 UTSW 2 180660701 missense probably benign 0.03
R6437:Dido1 UTSW 2 180675013 missense probably damaging 1.00
R6477:Dido1 UTSW 2 180660481 missense probably benign 0.00
R6836:Dido1 UTSW 2 180662307 missense probably benign 0.16
V1024:Dido1 UTSW 2 180689014 missense probably benign 0.12
X0011:Dido1 UTSW 2 180660834 missense probably benign 0.00
X0019:Dido1 UTSW 2 180671572 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCTTGGCCTTGGAATCCTGATGTG -3'
(R):5'- ATGAGAAGCGGACTCGACTCCAAC -3'

Sequencing Primer
(F):5'- TCCAGACGGCTCAAATGATTTC -3'
(R):5'- GGACTCGACTCCAACAGGAAG -3'
Posted On2014-03-28