Incidental Mutation 'R1466:Chek1'
ID166062
Institutional Source Beutler Lab
Gene Symbol Chek1
Ensembl Gene ENSMUSG00000032113
Gene Namecheckpoint kinase 1
SynonymsChk1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1466 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location36708482-36727065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36725857 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 2 (A2E)
Ref Sequence ENSEMBL: ENSMUSP00000134029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034625] [ENSMUST00000120381] [ENSMUST00000172702] [ENSMUST00000172742] [ENSMUST00000173963]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034625
AA Change: A2E

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034625
Gene: ENSMUSG00000032113
AA Change: A2E

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120381
SMART Domains Protein: ENSMUSP00000113116
Gene: ENSMUSG00000032116

DomainStartEndE-ValueType
Pfam:STT3 17 484 2e-163 PFAM
Pfam:PMT_2 97 257 9.3e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172702
AA Change: A2E

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134388
Gene: ENSMUSG00000032113
AA Change: A2E

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172742
AA Change: A2E

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133589
Gene: ENSMUSG00000032113
AA Change: A2E

DomainStartEndE-ValueType
Pfam:Pkinase 9 73 9.9e-13 PFAM
Pfam:Pkinase_Tyr 9 74 8.5e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173534
AA Change: A2E

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134013
Gene: ENSMUSG00000032113
AA Change: A2E

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173796
Predicted Effect probably damaging
Transcript: ENSMUST00000173963
AA Change: A2E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134029
Gene: ENSMUSG00000032113
AA Change: A2E

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174105
SMART Domains Protein: ENSMUSP00000134398
Gene: ENSMUSG00000032113

DomainStartEndE-ValueType
STYKc 1 99 4.6e-3 SMART
low complexity region 114 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174794
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr protein kinase family. It is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. This protein acts to integrate signals from ATM and ATR, two cell cycle proteins involved in DNA damage responses, that also associate with chromatin in meiotic prophase I. Phosphorylation of CDC25A protein phosphatase by this protein is required for cells to delay cell cycle progression in response to double-strand DNA breaks. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality between E2.5 and E7.5, impaired cell cycle checkpoint function, increase in blastocyst apoptosis and lack of inner cell mass proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
Adamts12 T C 15: 11,311,359 F1234S probably benign Het
Ahnak A G 19: 9,015,875 D4841G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arhgef17 G T 7: 100,929,659 P694Q possibly damaging Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
Aspg A G 12: 112,121,852 N385D probably benign Het
Atxn3 G A 12: 101,926,499 R319C possibly damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
C1s1 C T 6: 124,531,131 C633Y probably damaging Het
C8g C T 2: 25,500,216 A6T probably benign Het
Cbl A T 9: 44,154,244 V706E probably benign Het
Cfhr1 C T 1: 139,557,574 E45K probably benign Het
Chd7 G A 4: 8,840,561 probably null Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Corin C T 5: 72,302,790 probably null Het
Crb2 T C 2: 37,783,388 Y99H probably damaging Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Cym G A 3: 107,213,458 T277I probably damaging Het
Cyp2d11 C T 15: 82,391,735 C215Y probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dnah10 T A 5: 124,763,096 Y1265N probably benign Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Efhb A G 17: 53,437,178 F462L probably damaging Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Fat3 A C 9: 16,375,482 V915G probably damaging Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Galnt4 A G 10: 99,108,709 R99G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm10110 A T 14: 89,898,075 noncoding transcript Het
Gm4884 A G 7: 41,043,128 K174E probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grip2 A T 6: 91,788,443 D19E probably damaging Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T A 8: 110,532,953 V2519E possibly damaging Het
Ints11 G A 4: 155,888,110 probably null Het
Kif1a A G 1: 93,054,929 W718R possibly damaging Het
Kif1b A T 4: 149,223,252 Y839N probably damaging Het
Kif20b T A 19: 34,950,599 V1047D probably benign Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Klra10 T A 6: 130,279,315 R125S probably damaging Het
Klra10 T C 6: 130,279,431 N87D probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Map4k2 G T 19: 6,341,917 W87L probably damaging Het
Mccc1 A G 3: 35,974,286 V457A probably benign Het
Mdn1 T A 4: 32,730,788 S2886T probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrpl24 T A 3: 87,921,928 Y21* probably null Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Mtcl1 T A 17: 66,380,435 D492V probably damaging Het
Muc2 A G 7: 141,748,974 Y457C probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Myg1 T A 15: 102,337,390 L275Q probably damaging Het
Naga T A 15: 82,334,788 M237L probably null Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr103 A T 17: 37,336,956 L92H probably benign Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr46 A G 7: 140,610,969 I268V probably benign Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pcdh10 T G 3: 45,379,974 L241R probably damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Ppef1 C A X: 160,625,674 probably null Het
Prkaa1 C A 15: 5,178,798 P507T probably benign Het
Ptch1 A G 13: 63,524,969 Y804H probably benign Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rfx5 T A 3: 94,956,303 Y88N probably damaging Het
Rnase2b A T 14: 51,162,839 K126* probably null Het
Rpl3l A G 17: 24,730,871 I15V probably benign Het
Saal1 G T 7: 46,702,545 probably null Het
Sbpl A C 17: 23,953,254 D230E unknown Het
Scn10a T C 9: 119,666,490 Y322C probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc25a36 A G 9: 97,080,355 F194L probably damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc7a11 G T 3: 50,381,073 probably null Het
Slco4c1 A T 1: 96,841,172 S322T probably damaging Het
Smarcc2 A T 10: 128,474,245 T376S probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Syp A T X: 7,648,705 probably benign Het
Tas1r2 A G 4: 139,669,411 D687G probably damaging Het
Tekt4 A T 17: 25,472,074 Q118L probably benign Het
Tph2 T C 10: 115,079,695 N480S probably benign Het
Tsc2 A T 17: 24,608,973 M839K probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Uaca C T 9: 60,854,321 A205V possibly damaging Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Zfp704 G T 3: 9,447,348 T288N possibly damaging Het
Zfp93 T C 7: 24,276,096 V502A probably damaging Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Chek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Chek1 APN 9 36722599 splice site probably null
IGL01061:Chek1 APN 9 36714519 missense possibly damaging 0.70
IGL01322:Chek1 APN 9 36718421 nonsense probably null
IGL01627:Chek1 APN 9 36723895 missense probably damaging 1.00
IGL02379:Chek1 APN 9 36723946 missense probably benign 0.03
IGL03160:Chek1 APN 9 36722645 missense probably damaging 1.00
R0558:Chek1 UTSW 9 36712115 missense possibly damaging 0.72
R1035:Chek1 UTSW 9 36716473 missense probably damaging 1.00
R1466:Chek1 UTSW 9 36725857 missense probably damaging 1.00
R1606:Chek1 UTSW 9 36719524 missense probably damaging 1.00
R1627:Chek1 UTSW 9 36714441 missense probably benign
R2152:Chek1 UTSW 9 36723983 missense probably damaging 1.00
R2153:Chek1 UTSW 9 36723983 missense probably damaging 1.00
R2154:Chek1 UTSW 9 36723983 missense probably damaging 1.00
R2270:Chek1 UTSW 9 36719686 missense probably damaging 1.00
R4014:Chek1 UTSW 9 36722754 splice site probably benign
R5285:Chek1 UTSW 9 36714452 missense probably benign 0.00
R5458:Chek1 UTSW 9 36714429 missense probably benign 0.30
R5547:Chek1 UTSW 9 36712104 missense probably benign 0.02
R5819:Chek1 UTSW 9 36710405 missense probably benign 0.01
R5853:Chek1 UTSW 9 36713687 missense probably damaging 1.00
R6334:Chek1 UTSW 9 36714492 missense possibly damaging 0.59
R6353:Chek1 UTSW 9 36723959 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCCTAATGATCCCTCCAAACCTTC -3'
(R):5'- CCGAAAGCTCTTGTCTTGCAACCC -3'

Sequencing Primer
(F):5'- accagctcctgcaagttgtc -3'
(R):5'- CTCAGTTTTGCATAAAGGCGGAC -3'
Posted On2014-03-28