Incidental Mutation 'R1466:Mtcl1'
ID166104
Institutional Source Beutler Lab
Gene Symbol Mtcl1
Ensembl Gene ENSMUSG00000052105
Gene Namemicrotubule crosslinking factor 1
SynonymsSoga2, t8219b25, 1110012J17Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R1466 (G1)
Quality Score126
Status Not validated
Chromosome17
Chromosomal Location66336982-66449750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66380435 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 492 (D492V)
Ref Sequence ENSEMBL: ENSMUSP00000094894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086693] [ENSMUST00000097291] [ENSMUST00000145347] [ENSMUST00000177034]
Predicted Effect probably damaging
Transcript: ENSMUST00000086693
AA Change: D492V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083899
Gene: ENSMUSG00000052105
AA Change: D492V

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 54 98 N/A INTRINSIC
low complexity region 99 120 N/A INTRINSIC
low complexity region 127 132 N/A INTRINSIC
low complexity region 166 183 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
SCOP:d1fxkc_ 332 466 3e-7 SMART
Blast:BRLZ 339 362 1e-5 BLAST
Pfam:DUF3166 493 587 1.8e-34 PFAM
Pfam:DUF3166 622 714 3.8e-39 PFAM
low complexity region 843 859 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
coiled coil region 1120 1159 N/A INTRINSIC
Pfam:DUF4482 1220 1344 3e-40 PFAM
low complexity region 1464 1476 N/A INTRINSIC
low complexity region 1672 1681 N/A INTRINSIC
low complexity region 1912 1924 N/A INTRINSIC
low complexity region 1931 1943 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097291
AA Change: D492V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000094894
Gene: ENSMUSG00000052105
AA Change: D492V

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 54 98 N/A INTRINSIC
low complexity region 99 120 N/A INTRINSIC
low complexity region 127 132 N/A INTRINSIC
low complexity region 166 183 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
SCOP:d1fxkc_ 332 466 3e-7 SMART
Blast:BRLZ 339 362 1e-5 BLAST
Pfam:DUF3166 492 588 1.8e-43 PFAM
Pfam:DUF3166 621 716 5e-19 PFAM
low complexity region 843 859 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
coiled coil region 1120 1159 N/A INTRINSIC
Pfam:DUF4482 1220 1392 3.9e-49 PFAM
low complexity region 1464 1476 N/A INTRINSIC
low complexity region 1672 1681 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144492
Predicted Effect probably damaging
Transcript: ENSMUST00000145347
AA Change: D43V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121387
Gene: ENSMUSG00000052105
AA Change: D43V

DomainStartEndE-ValueType
Pfam:DUF3166 43 139 9.1e-44 PFAM
Pfam:DUF3166 172 267 2.5e-19 PFAM
low complexity region 394 410 N/A INTRINSIC
low complexity region 447 461 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 600 613 N/A INTRINSIC
coiled coil region 671 710 N/A INTRINSIC
Pfam:DUF4482 771 910 4.6e-49 PFAM
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1223 1232 N/A INTRINSIC
low complexity region 1463 1475 N/A INTRINSIC
low complexity region 1482 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177034
AA Change: D140V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135690
Gene: ENSMUSG00000052105
AA Change: D140V

DomainStartEndE-ValueType
Pfam:DUF3166 140 236 1.5e-43 PFAM
Pfam:DUF3166 269 364 4e-19 PFAM
low complexity region 491 507 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
coiled coil region 642 674 N/A INTRINSIC
low complexity region 738 751 N/A INTRINSIC
coiled coil region 809 848 N/A INTRINSIC
Pfam:DUF4482 909 1042 4e-49 PFAM
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1369 1378 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Global or Purkinje cell-specific homozygous knockout affects Purkinje cell axon and dendrite morphology, resulting in abnormal motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
Adamts12 T C 15: 11,311,359 F1234S probably benign Het
Ahnak A G 19: 9,015,875 D4841G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arhgef17 G T 7: 100,929,659 P694Q possibly damaging Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
Aspg A G 12: 112,121,852 N385D probably benign Het
Atxn3 G A 12: 101,926,499 R319C possibly damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
C1s1 C T 6: 124,531,131 C633Y probably damaging Het
C8g C T 2: 25,500,216 A6T probably benign Het
Cbl A T 9: 44,154,244 V706E probably benign Het
Cfhr1 C T 1: 139,557,574 E45K probably benign Het
Chd7 G A 4: 8,840,561 probably null Het
Chek1 G T 9: 36,725,857 A2E probably damaging Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Corin C T 5: 72,302,790 probably null Het
Crb2 T C 2: 37,783,388 Y99H probably damaging Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Cym G A 3: 107,213,458 T277I probably damaging Het
Cyp2d11 C T 15: 82,391,735 C215Y probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dnah10 T A 5: 124,763,096 Y1265N probably benign Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Efhb A G 17: 53,437,178 F462L probably damaging Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Fat3 A C 9: 16,375,482 V915G probably damaging Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Galnt4 A G 10: 99,108,709 R99G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm10110 A T 14: 89,898,075 noncoding transcript Het
Gm4884 A G 7: 41,043,128 K174E probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grip2 A T 6: 91,788,443 D19E probably damaging Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T A 8: 110,532,953 V2519E possibly damaging Het
Ints11 G A 4: 155,888,110 probably null Het
Kif1a A G 1: 93,054,929 W718R possibly damaging Het
Kif1b A T 4: 149,223,252 Y839N probably damaging Het
Kif20b T A 19: 34,950,599 V1047D probably benign Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Klra10 T A 6: 130,279,315 R125S probably damaging Het
Klra10 T C 6: 130,279,431 N87D probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Map4k2 G T 19: 6,341,917 W87L probably damaging Het
Mccc1 A G 3: 35,974,286 V457A probably benign Het
Mdn1 T A 4: 32,730,788 S2886T probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrpl24 T A 3: 87,921,928 Y21* probably null Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Muc2 A G 7: 141,748,974 Y457C probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Myg1 T A 15: 102,337,390 L275Q probably damaging Het
Naga T A 15: 82,334,788 M237L probably null Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr103 A T 17: 37,336,956 L92H probably benign Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr46 A G 7: 140,610,969 I268V probably benign Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pcdh10 T G 3: 45,379,974 L241R probably damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Ppef1 C A X: 160,625,674 probably null Het
Prkaa1 C A 15: 5,178,798 P507T probably benign Het
Ptch1 A G 13: 63,524,969 Y804H probably benign Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rfx5 T A 3: 94,956,303 Y88N probably damaging Het
Rnase2b A T 14: 51,162,839 K126* probably null Het
Rpl3l A G 17: 24,730,871 I15V probably benign Het
Saal1 G T 7: 46,702,545 probably null Het
Sbpl A C 17: 23,953,254 D230E unknown Het
Scn10a T C 9: 119,666,490 Y322C probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc25a36 A G 9: 97,080,355 F194L probably damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc7a11 G T 3: 50,381,073 probably null Het
Slco4c1 A T 1: 96,841,172 S322T probably damaging Het
Smarcc2 A T 10: 128,474,245 T376S probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Syp A T X: 7,648,705 probably benign Het
Tas1r2 A G 4: 139,669,411 D687G probably damaging Het
Tekt4 A T 17: 25,472,074 Q118L probably benign Het
Tph2 T C 10: 115,079,695 N480S probably benign Het
Tsc2 A T 17: 24,608,973 M839K probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Uaca C T 9: 60,854,321 A205V possibly damaging Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Zfp704 G T 3: 9,447,348 T288N possibly damaging Het
Zfp93 T C 7: 24,276,096 V502A probably damaging Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Mtcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Mtcl1 APN 17 66344319 missense probably benign 0.00
IGL01774:Mtcl1 APN 17 66385885 missense probably damaging 1.00
IGL01918:Mtcl1 APN 17 66368268 missense possibly damaging 0.47
IGL02000:Mtcl1 APN 17 66354190 missense probably benign 0.19
IGL02074:Mtcl1 APN 17 66366468 missense possibly damaging 0.68
IGL02338:Mtcl1 APN 17 66379970 missense probably damaging 1.00
IGL02597:Mtcl1 APN 17 66338021 missense probably benign
IGL03034:Mtcl1 APN 17 66344198 missense probably damaging 1.00
IGL03120:Mtcl1 APN 17 66379383 missense probably damaging 0.96
IGL03184:Mtcl1 APN 17 66354214 missense probably benign 0.01
IGL03240:Mtcl1 APN 17 66338019 missense probably damaging 1.00
IGL03294:Mtcl1 APN 17 66338019 missense probably damaging 1.00
IGL03332:Mtcl1 APN 17 66338019 missense probably damaging 1.00
R0110:Mtcl1 UTSW 17 66358114 missense possibly damaging 0.51
R0113:Mtcl1 UTSW 17 66354242 missense possibly damaging 0.52
R0321:Mtcl1 UTSW 17 66379431 missense probably damaging 1.00
R0366:Mtcl1 UTSW 17 66338129 missense probably damaging 1.00
R0629:Mtcl1 UTSW 17 66338142 missense possibly damaging 0.89
R1467:Mtcl1 UTSW 17 66448327 missense probably damaging 1.00
R1471:Mtcl1 UTSW 17 66379148 missense probably damaging 0.96
R1650:Mtcl1 UTSW 17 66385876 missense probably damaging 1.00
R1754:Mtcl1 UTSW 17 66380183 missense probably damaging 1.00
R1855:Mtcl1 UTSW 17 66379514 missense probably benign
R1882:Mtcl1 UTSW 17 66379320 missense probably benign 0.01
R1935:Mtcl1 UTSW 17 66379414 missense probably benign 0.10
R2063:Mtcl1 UTSW 17 66346355 missense probably damaging 1.00
R2132:Mtcl1 UTSW 17 66343623 missense probably benign 0.04
R2197:Mtcl1 UTSW 17 66366432 missense probably benign
R3196:Mtcl1 UTSW 17 66343834 missense probably benign 0.07
R3877:Mtcl1 UTSW 17 66342954 missense probably damaging 1.00
R4116:Mtcl1 UTSW 17 66366481 missense probably benign
R4204:Mtcl1 UTSW 17 66438261 missense probably damaging 1.00
R4373:Mtcl1 UTSW 17 66380079 missense probably benign 0.05
R4396:Mtcl1 UTSW 17 66344225 missense probably damaging 1.00
R4591:Mtcl1 UTSW 17 66348511 missense probably benign 0.07
R4610:Mtcl1 UTSW 17 66377887 missense probably benign 0.04
R4681:Mtcl1 UTSW 17 66449144 missense unknown
R4922:Mtcl1 UTSW 17 66348479 missense probably benign 0.29
R4992:Mtcl1 UTSW 17 66342839 missense probably damaging 0.99
R5169:Mtcl1 UTSW 17 66343823 missense probably benign 0.00
R5542:Mtcl1 UTSW 17 66384359 intron probably benign
R5804:Mtcl1 UTSW 17 66343137 missense probably benign 0.03
R5998:Mtcl1 UTSW 17 66368280 missense probably damaging 0.99
R6163:Mtcl1 UTSW 17 66379331 missense probably benign 0.10
R6191:Mtcl1 UTSW 17 66343526 missense probably damaging 1.00
R6254:Mtcl1 UTSW 17 66358134 missense probably benign 0.02
R6260:Mtcl1 UTSW 17 66343541 missense probably damaging 1.00
R6524:Mtcl1 UTSW 17 66348285 missense probably benign 0.15
R6884:Mtcl1 UTSW 17 66438202 missense probably damaging 1.00
X0065:Mtcl1 UTSW 17 66379607 missense probably damaging 1.00
Z1088:Mtcl1 UTSW 17 66343728 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACTTCAGCCGCAGTTTCAGCTC -3'
(R):5'- AGACTCCAAGACTCACTGCTGCTC -3'

Sequencing Primer
(F):5'- GCAGTTTCAGCTCTGCCTC -3'
(R):5'- cagcaccaacaggaagaatg -3'
Posted On2014-03-28