Incidental Mutation 'R1531:Lrrc23'
Institutional Source Beutler Lab
Gene Symbol Lrrc23
Ensembl Gene ENSMUSG00000030125
Gene Nameleucine rich repeat containing 23
Synonyms4921537K05Rik, Lrpb7
MMRRC Submission 039570-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1531 (G1)
Quality Score225
Status Not validated
Chromosomal Location124769863-124779727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124776114 bp
Amino Acid Change Serine to Proline at position 190 (S190P)
Ref Sequence ENSEMBL: ENSMUSP00000108094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032218] [ENSMUST00000112475] [ENSMUST00000128697] [ENSMUST00000147669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032218
AA Change: S190P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032218
Gene: ENSMUSG00000030125
AA Change: S190P

coiled coil region 12 40 N/A INTRINSIC
Pfam:LRR_1 89 109 1.2e-2 PFAM
LRR 196 217 1.33e2 SMART
LRR 218 239 4.97e0 SMART
LRR 241 263 3.27e1 SMART
low complexity region 305 314 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112475
AA Change: S190P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108094
Gene: ENSMUSG00000030125
AA Change: S190P

coiled coil region 12 40 N/A INTRINSIC
internal_repeat_1 90 182 7.1e-5 PROSPERO
LRR 196 217 1.33e2 SMART
LRR 218 239 4.97e0 SMART
LRR 241 263 3.27e1 SMART
low complexity region 305 314 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128697
SMART Domains Protein: ENSMUSP00000122362
Gene: ENSMUSG00000030125

coiled coil region 12 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132492
Predicted Effect probably benign
Transcript: ENSMUST00000147669
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A G 10: 43,525,320 V211A probably benign Het
Agtpbp1 T A 13: 59,500,634 probably null Het
Aldh3b2 T G 19: 3,977,543 F28C probably damaging Het
Apaf1 T C 10: 91,054,521 N540S probably damaging Het
Apob T C 12: 7,997,880 I953T possibly damaging Het
Arhgef1 A G 7: 24,924,998 T816A probably damaging Het
Arid4a T A 12: 71,076,005 F1053L probably benign Het
Atxn1l A C 8: 109,732,059 F524V probably damaging Het
Cad T A 5: 31,076,219 M1874K probably benign Het
Ccdc40 G A 11: 119,263,189 V1096I probably benign Het
Ccdc93 A G 1: 121,480,822 D358G probably benign Het
Cd96 T C 16: 46,117,806 T99A probably benign Het
Cdc42ep3 A T 17: 79,335,044 M149K probably benign Het
Cog4 A G 8: 110,879,721 E613G probably benign Het
Crebbp A T 16: 4,084,517 I2286N probably benign Het
Csf1 T C 3: 107,748,338 E459G possibly damaging Het
Csrp2 A T 10: 110,935,205 Y57F probably benign Het
Ctdspl C T 9: 119,040,582 P244L probably damaging Het
Cyp2c29 A G 19: 39,324,968 R303G probably damaging Het
Cyp4a10 C A 4: 115,518,435 Y38* probably null Het
Dmgdh T A 13: 93,744,411 I783N probably damaging Het
Efcc1 G A 6: 87,731,166 E92K probably benign Het
Eif2ak4 T A 2: 118,443,210 L872H probably damaging Het
Elp2 T A 18: 24,631,404 S603T probably benign Het
Eml2 T A 7: 19,196,254 L300H probably damaging Het
Esp3 A G 17: 40,635,936 K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 F136L probably damaging Het
Exoc1 T A 5: 76,559,164 D497E probably damaging Het
Fat3 A G 9: 15,997,465 S2414P probably damaging Het
Foxj3 C T 4: 119,620,201 P369S unknown Het
Gkn2 G T 6: 87,375,939 probably null Het
Gm21905 A T 5: 67,946,381 probably benign Het
Grhl1 T A 12: 24,582,963 probably null Het
Grk6 A G 13: 55,452,154 Y221C probably damaging Het
Hcrtr1 T A 4: 130,130,927 K389* probably null Het
Hk1 G A 10: 62,284,784 R545C probably damaging Het
Hsp90b1 A T 10: 86,696,795 I339N probably benign Het
Ikzf3 T C 11: 98,490,446 R103G probably damaging Het
Itgad A C 7: 128,178,370 I141L probably benign Het
Jmjd6 T A 11: 116,842,440 Y137F probably benign Het
Kcna1 A G 6: 126,642,067 V430A probably benign Het
Kel A G 6: 41,688,626 V520A probably damaging Het
Klhl41 G A 2: 69,670,740 V182I probably benign Het
Ldhb C A 6: 142,501,395 M64I probably benign Het
Mb21d1 A G 9: 78,442,481 Y200H probably damaging Het
Mboat2 T C 12: 24,959,030 V445A probably benign Het
Mlycd G A 8: 119,401,519 W188* probably null Het
Mpp3 C T 11: 102,008,649 E349K probably benign Het
Myh4 A G 11: 67,250,540 M780V probably benign Het
Myh6 G A 14: 54,956,506 R809C probably damaging Het
Mylip G A 13: 45,406,570 V161M possibly damaging Het
Nrp1 G A 8: 128,425,969 V220I probably null Het
Nup210 A T 6: 91,034,841 N455K probably benign Het
Olfr116 A T 17: 37,624,352 Y94* probably null Het
Olfr583 C A 7: 103,051,588 Q97K probably benign Het
Pbld2 G T 10: 63,053,953 probably null Het
Pclo C G 5: 14,521,903 P434R probably damaging Het
Pdlim3 A G 8: 45,896,763 K37E probably damaging Het
Prkdc T A 16: 15,772,106 I2611N probably benign Het
Prr12 T C 7: 45,028,530 D2019G unknown Het
Rab27a A G 9: 73,095,403 T205A probably benign Het
Rcan3 A G 4: 135,425,284 L42P probably damaging Het
Rchy1 T C 5: 91,955,615 probably null Het
Sema6a T C 18: 47,248,999 H827R probably damaging Het
Sertad4 A G 1: 192,850,950 probably null Het
Smarcd1 T A 15: 99,707,383 C282S probably damaging Het
Speg A G 1: 75,401,222 T769A possibly damaging Het
Syne1 T A 10: 5,347,875 K1141* probably null Het
Synpo2 T C 3: 123,117,666 E110G probably benign Het
Tg T A 15: 66,850,502 D333E probably benign Het
Tmem132c A G 5: 127,359,891 Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 V14E probably damaging Het
Tmem229b A G 12: 78,964,911 L82P probably damaging Het
Togaram1 A G 12: 64,966,265 T97A probably benign Het
Trappc9 G A 15: 72,693,548 R965* probably null Het
Trio T C 15: 27,832,985 I104V probably benign Het
Trp73 A G 4: 154,063,895 F354S probably benign Het
Ttyh2 T C 11: 114,686,452 L63P probably damaging Het
Ulk4 G C 9: 121,044,775 P1197A probably damaging Het
Vmn1r176 T C 7: 23,835,111 M206V possibly damaging Het
Vps8 T A 16: 21,466,476 Y402* probably null Het
Zbtb41 A G 1: 139,423,193 I15V probably benign Het
Zc3hav1 T C 6: 38,307,235 I982V possibly damaging Het
Zmynd19 T A 2: 24,958,111 N106K probably benign Het
Other mutations in Lrrc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Lrrc23 APN 6 124778926 missense probably damaging 1.00
IGL01123:Lrrc23 APN 6 124778819 missense probably benign 0.04
IGL02429:Lrrc23 APN 6 124778167 missense probably damaging 0.99
IGL02892:Lrrc23 APN 6 124774436 missense probably benign 0.03
R0440:Lrrc23 UTSW 6 124770704 missense probably benign 0.00
R0637:Lrrc23 UTSW 6 124778358 unclassified probably benign
R1055:Lrrc23 UTSW 6 124778151 missense probably damaging 1.00
R1125:Lrrc23 UTSW 6 124776182 missense probably benign 0.06
R4156:Lrrc23 UTSW 6 124770841 nonsense probably null
R4838:Lrrc23 UTSW 6 124778189 missense probably benign 0.16
R5296:Lrrc23 UTSW 6 124774482 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agcctctaactcctccttacc -3'
Posted On2014-04-13