Incidental Mutation 'R1531:Eml2'
ID166200
Institutional Source Beutler Lab
Gene Symbol Eml2
Ensembl Gene ENSMUSG00000040811
Gene Nameechinoderm microtubule associated protein like 2
Synonyms1600029N02Rik
MMRRC Submission 039570-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1531 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19176421-19206482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19196254 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 300 (L300H)
Ref Sequence ENSEMBL: ENSMUSP00000115466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000148246]
Predicted Effect probably damaging
Transcript: ENSMUST00000048502
AA Change: L319H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: L319H

DomainStartEndE-ValueType
Pfam:HELP 17 65 4.6e-14 PFAM
WD40 113 162 8.36e-2 SMART
WD40 165 210 9.21e0 SMART
WD40 213 252 7.99e-1 SMART
WD40 258 298 3.7e0 SMART
WD40 301 341 3.58e-1 SMART
WD40 385 424 5.52e-2 SMART
WD40 427 465 1.1e1 SMART
WD40 468 507 4.95e-4 SMART
WD40 514 553 4.62e-4 SMART
WD40 579 620 4.75e1 SMART
WD40 626 666 2.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117338
AA Change: L492H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: L492H

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
coiled coil region 59 106 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
Pfam:HELP 211 285 3.5e-29 PFAM
WD40 286 335 5.5e-4 SMART
WD40 338 383 5.8e-2 SMART
WD40 386 425 5.2e-3 SMART
WD40 431 471 2.4e-2 SMART
WD40 474 514 2.3e-3 SMART
WD40 558 597 3.6e-4 SMART
WD40 600 638 7.1e-2 SMART
WD40 641 680 3.1e-6 SMART
WD40 687 726 3.1e-6 SMART
WD40 752 793 3e-1 SMART
WD40 799 839 1.7e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120595
AA Change: L300H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: L300H

DomainStartEndE-ValueType
WD40 94 154 2.48e0 SMART
WD40 157 196 7.99e-1 SMART
WD40 202 242 3.7e0 SMART
WD40 245 285 3.58e-1 SMART
WD40 329 368 5.52e-2 SMART
WD40 371 409 1.1e1 SMART
WD40 412 451 4.95e-4 SMART
WD40 458 497 4.62e-4 SMART
WD40 523 564 4.75e1 SMART
WD40 570 610 2.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148246
AA Change: L300H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811
AA Change: L300H

DomainStartEndE-ValueType
WD40 94 143 8.36e-2 SMART
WD40 146 191 9.21e0 SMART
WD40 194 233 7.99e-1 SMART
WD40 239 279 3.7e0 SMART
WD40 282 322 3.58e-1 SMART
WD40 366 405 5.52e-2 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A G 10: 43,525,320 V211A probably benign Het
Agtpbp1 T A 13: 59,500,634 probably null Het
Aldh3b2 T G 19: 3,977,543 F28C probably damaging Het
Apaf1 T C 10: 91,054,521 N540S probably damaging Het
Apob T C 12: 7,997,880 I953T possibly damaging Het
Arhgef1 A G 7: 24,924,998 T816A probably damaging Het
Arid4a T A 12: 71,076,005 F1053L probably benign Het
Atxn1l A C 8: 109,732,059 F524V probably damaging Het
Cad T A 5: 31,076,219 M1874K probably benign Het
Ccdc40 G A 11: 119,263,189 V1096I probably benign Het
Ccdc93 A G 1: 121,480,822 D358G probably benign Het
Cd96 T C 16: 46,117,806 T99A probably benign Het
Cdc42ep3 A T 17: 79,335,044 M149K probably benign Het
Cog4 A G 8: 110,879,721 E613G probably benign Het
Crebbp A T 16: 4,084,517 I2286N probably benign Het
Csf1 T C 3: 107,748,338 E459G possibly damaging Het
Csrp2 A T 10: 110,935,205 Y57F probably benign Het
Ctdspl C T 9: 119,040,582 P244L probably damaging Het
Cyp2c29 A G 19: 39,324,968 R303G probably damaging Het
Cyp4a10 C A 4: 115,518,435 Y38* probably null Het
Dmgdh T A 13: 93,744,411 I783N probably damaging Het
Efcc1 G A 6: 87,731,166 E92K probably benign Het
Eif2ak4 T A 2: 118,443,210 L872H probably damaging Het
Elp2 T A 18: 24,631,404 S603T probably benign Het
Esp3 A G 17: 40,635,936 K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 F136L probably damaging Het
Exoc1 T A 5: 76,559,164 D497E probably damaging Het
Fat3 A G 9: 15,997,465 S2414P probably damaging Het
Foxj3 C T 4: 119,620,201 P369S unknown Het
Gkn2 G T 6: 87,375,939 probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gm21905 A T 5: 67,946,381 probably benign Het
Grhl1 T A 12: 24,582,963 probably null Het
Grk6 A G 13: 55,452,154 Y221C probably damaging Het
Hcrtr1 T A 4: 130,130,927 K389* probably null Het
Hk1 G A 10: 62,284,784 R545C probably damaging Het
Hsp90b1 A T 10: 86,696,795 I339N probably benign Het
Ikzf3 T C 11: 98,490,446 R103G probably damaging Het
Itgad A C 7: 128,178,370 I141L probably benign Het
Jmjd6 T A 11: 116,842,440 Y137F probably benign Het
Kcna1 A G 6: 126,642,067 V430A probably benign Het
Kel A G 6: 41,688,626 V520A probably damaging Het
Klhl41 G A 2: 69,670,740 V182I probably benign Het
Ldhb C A 6: 142,501,395 M64I probably benign Het
Lrrc23 A G 6: 124,776,114 S190P possibly damaging Het
Mb21d1 A G 9: 78,442,481 Y200H probably damaging Het
Mboat2 T C 12: 24,959,030 V445A probably benign Het
Mlycd G A 8: 119,401,519 W188* probably null Het
Mpp3 C T 11: 102,008,649 E349K probably benign Het
Myh4 A G 11: 67,250,540 M780V probably benign Het
Myh6 G A 14: 54,956,506 R809C probably damaging Het
Mylip G A 13: 45,406,570 V161M possibly damaging Het
Nrp1 G A 8: 128,425,969 V220I probably null Het
Nup210 A T 6: 91,034,841 N455K probably benign Het
Olfr116 A T 17: 37,624,352 Y94* probably null Het
Olfr583 C A 7: 103,051,588 Q97K probably benign Het
Pbld2 G T 10: 63,053,953 probably null Het
Pclo C G 5: 14,521,903 P434R probably damaging Het
Pdlim3 A G 8: 45,896,763 K37E probably damaging Het
Prkdc T A 16: 15,772,106 I2611N probably benign Het
Prr12 T C 7: 45,028,530 D2019G unknown Het
Rab27a A G 9: 73,095,403 T205A probably benign Het
Rcan3 A G 4: 135,425,284 L42P probably damaging Het
Rchy1 T C 5: 91,955,615 probably null Het
Sema6a T C 18: 47,248,999 H827R probably damaging Het
Sertad4 A G 1: 192,850,950 probably null Het
Smarcd1 T A 15: 99,707,383 C282S probably damaging Het
Speg A G 1: 75,401,222 T769A possibly damaging Het
Syne1 T A 10: 5,347,875 K1141* probably null Het
Synpo2 T C 3: 123,117,666 E110G probably benign Het
Tg T A 15: 66,850,502 D333E probably benign Het
Tmem132c A G 5: 127,359,891 Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 V14E probably damaging Het
Tmem229b A G 12: 78,964,911 L82P probably damaging Het
Togaram1 A G 12: 64,966,265 T97A probably benign Het
Trappc9 G A 15: 72,693,548 R965* probably null Het
Trio T C 15: 27,832,985 I104V probably benign Het
Trp73 A G 4: 154,063,895 F354S probably benign Het
Ttyh2 T C 11: 114,686,452 L63P probably damaging Het
Ulk4 G C 9: 121,044,775 P1197A probably damaging Het
Vmn1r176 T C 7: 23,835,111 M206V possibly damaging Het
Vps8 T A 16: 21,466,476 Y402* probably null Het
Zbtb41 A G 1: 139,423,193 I15V probably benign Het
Zc3hav1 T C 6: 38,307,235 I982V possibly damaging Het
Zmynd19 T A 2: 24,958,111 N106K probably benign Het
Other mutations in Eml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Eml2 APN 7 19206143 missense probably damaging 1.00
IGL00786:Eml2 APN 7 19202582 missense probably damaging 1.00
IGL01084:Eml2 APN 7 19190738 nonsense probably null
IGL01132:Eml2 APN 7 19200539 missense probably damaging 1.00
IGL01678:Eml2 APN 7 19186122 missense probably benign 0.38
IGL01800:Eml2 APN 7 19201197 intron probably benign
IGL02517:Eml2 APN 7 19206130 missense probably damaging 1.00
IGL02607:Eml2 APN 7 19206111 missense probably damaging 1.00
IGL02676:Eml2 APN 7 19184921 nonsense probably null
IGL03082:Eml2 APN 7 19201877 missense probably damaging 1.00
puffery UTSW 7 19201163 missense probably damaging 1.00
R0040:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R0135:Eml2 UTSW 7 19203952 missense probably damaging 1.00
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0362:Eml2 UTSW 7 19190806 unclassified probably null
R0387:Eml2 UTSW 7 19182259 splice site probably null
R0432:Eml2 UTSW 7 19179531 nonsense probably null
R0614:Eml2 UTSW 7 19202591 missense probably damaging 1.00
R0628:Eml2 UTSW 7 19201554 splice site probably benign
R1078:Eml2 UTSW 7 19179762 missense probably benign 0.24
R1856:Eml2 UTSW 7 19194061 missense probably damaging 0.97
R1864:Eml2 UTSW 7 19201878 missense probably damaging 1.00
R1937:Eml2 UTSW 7 19203964 missense possibly damaging 0.68
R2032:Eml2 UTSW 7 19202555 missense probably benign 0.03
R2185:Eml2 UTSW 7 19194028 missense probably damaging 1.00
R2419:Eml2 UTSW 7 19176695 unclassified probably benign
R3821:Eml2 UTSW 7 19202986 missense possibly damaging 0.94
R4199:Eml2 UTSW 7 19179439 missense probably benign 0.00
R4411:Eml2 UTSW 7 19182401 critical splice donor site probably null
R4497:Eml2 UTSW 7 19179350 missense probably damaging 1.00
R4885:Eml2 UTSW 7 19204010 missense probably benign 0.05
R4912:Eml2 UTSW 7 19193999 splice site probably null
R5028:Eml2 UTSW 7 19179447 critical splice donor site probably null
R5192:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5196:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5373:Eml2 UTSW 7 19179263 missense possibly damaging 0.92
R5718:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5719:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5720:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5727:Eml2 UTSW 7 19190760 missense probably damaging 0.99
R5841:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5842:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5843:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5844:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6014:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6015:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6017:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6073:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6075:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6126:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6128:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6129:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6189:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6190:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6258:Eml2 UTSW 7 19179364 unclassified probably null
R6273:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6289:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6376:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6378:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6381:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6384:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6394:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6435:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6436:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6437:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6476:Eml2 UTSW 7 19196311 missense probably benign 0.26
R6550:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6551:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6552:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6554:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6572:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R6598:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6599:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6704:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6705:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6709:Eml2 UTSW 7 19206211 makesense probably null
R6730:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6734:Eml2 UTSW 7 19200507 missense probably benign 0.35
R6742:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6769:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6770:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6864:Eml2 UTSW 7 19196281 missense probably damaging 0.99
R6878:Eml2 UTSW 7 19200612 missense probably benign 0.08
R7045:Eml2 UTSW 7 19201579 missense probably damaging 1.00
R7260:Eml2 UTSW 7 19200590 missense probably benign 0.45
R7478:Eml2 UTSW 7 19206141 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGGGTAGTGTGTTCGAGACCAAG -3'
(R):5'- CAAGCAGCGAAAACCCTGTGTG -3'

Sequencing Primer
(F):5'- TGTGTTCGAGACCAAGAGAGAC -3'
(R):5'- AAGTCCTCTGGGACCTGAGTG -3'
Posted On2014-04-13