Incidental Mutation 'R1527:Lonrf2'
ID166261
Institutional Source Beutler Lab
Gene Symbol Lonrf2
Ensembl Gene ENSMUSG00000048814
Gene NameLON peptidase N-terminal domain and ring finger 2
Synonyms2900060P06Rik
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1527 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location38793645-38836711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38813276 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 165 (P165S)
Ref Sequence ENSEMBL: ENSMUSP00000117600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039612] [ENSMUST00000147695]
Predicted Effect probably benign
Transcript: ENSMUST00000039612
AA Change: P165S

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047372
Gene: ENSMUSG00000048814
AA Change: P165S

DomainStartEndE-ValueType
Blast:TPR 22 55 2e-14 BLAST
low complexity region 72 87 N/A INTRINSIC
RING 213 250 1.54e-5 SMART
Pfam:LON 301 498 4.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147695
AA Change: P165S

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117600
Gene: ENSMUSG00000048814
AA Change: P165S

DomainStartEndE-ValueType
Blast:TPR 22 55 2e-14 BLAST
low complexity region 72 87 N/A INTRINSIC
RING 213 250 1.54e-5 SMART
Pfam:LON_substr_bdg 301 498 2.6e-27 PFAM
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Lonrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Lonrf2 APN 1 38812535 splice site probably benign
IGL02369:Lonrf2 APN 1 38811832 splice site probably benign
IGL02526:Lonrf2 APN 1 38800710 missense probably benign 0.02
gorged UTSW 1 38804336 missense probably benign 0.05
swollen UTSW 1 38813389 missense probably benign
R1450:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1541:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1655:Lonrf2 UTSW 1 38811824 missense probably damaging 0.98
R1679:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1681:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1711:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1732:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1758:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1768:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1795:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1831:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1832:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1833:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R2044:Lonrf2 UTSW 1 38807050 missense probably benign 0.17
R2054:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R2656:Lonrf2 UTSW 1 38815960 splice site probably null
R4084:Lonrf2 UTSW 1 38821151 missense probably benign 0.00
R4775:Lonrf2 UTSW 1 38818059 splice site probably null
R4796:Lonrf2 UTSW 1 38816038 missense probably benign 0.00
R5445:Lonrf2 UTSW 1 38807153 missense probably benign 0.05
R5875:Lonrf2 UTSW 1 38807047 missense probably benign 0.01
R5902:Lonrf2 UTSW 1 38807093 missense probably benign 0.17
R6441:Lonrf2 UTSW 1 38818123 missense possibly damaging 0.76
R6533:Lonrf2 UTSW 1 38813268 missense probably benign 0.08
R6695:Lonrf2 UTSW 1 38813389 missense probably benign
R6930:Lonrf2 UTSW 1 38804336 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAAAGAAGCCGGTCTCCTCATTTCC -3'
(R):5'- CCCATAGATTTCAGAGAAGGCTAACGC -3'

Sequencing Primer
(F):5'- CATTTCCTTATGGATTTCACTTGTG -3'
(R):5'- ggtttagtttgctttggtttgg -3'
Posted On2014-04-13