Incidental Mutation 'R1527:Haus3'
ID166279
Institutional Source Beutler Lab
Gene Symbol Haus3
Ensembl Gene ENSMUSG00000079555
Gene NameHAUS augmin-like complex, subunit 3
SynonymsD5H4S43, D4S43h, D5H4S43E
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1527 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34153880-34169527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34154053 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 544 (H544Q)
Ref Sequence ENSEMBL: ENSMUSP00000049973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042954] [ENSMUST00000060049] [ENSMUST00000202409] [ENSMUST00000202638]
Predicted Effect probably benign
Transcript: ENSMUST00000042954
SMART Domains Protein: ENSMUSP00000036110
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
POLAc 605 814 7.88e-67 SMART
low complexity region 829 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060049
AA Change: H544Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000049973
Gene: ENSMUSG00000079555
AA Change: H544Q

DomainStartEndE-ValueType
Pfam:HAUS-augmin3 29 282 4.8e-85 PFAM
coiled coil region 294 336 N/A INTRINSIC
coiled coil region 459 495 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202409
SMART Domains Protein: ENSMUSP00000144578
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 587 796 2.6e-69 SMART
low complexity region 811 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202638
SMART Domains Protein: ENSMUSP00000143793
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 605 770 3e-37 SMART
low complexity region 785 799 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the HAUS augmin-like protein complex, which plays a key role in cytokinesis and mitosis. Disruption of the encoded protein causes mitotic defects resulting from fragmentation of centrosomes and microtubule destabilization. This gene shares its 5' exons with some transcripts from overlapping GeneID: 353497, which encodes a DNA polymerase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit pre- or peri-implantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Haus3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Haus3 APN 5 34167928 missense probably benign 0.00
IGL00990:Haus3 APN 5 34166346 missense probably benign 0.00
IGL01311:Haus3 APN 5 34167644 nonsense probably null
IGL01906:Haus3 APN 5 34168323 intron probably benign
IGL01964:Haus3 APN 5 34166061 missense probably benign 0.19
IGL02383:Haus3 APN 5 34166236 nonsense probably null
IGL02584:Haus3 APN 5 34166258 nonsense probably null
IGL02800:Haus3 APN 5 34166324 missense possibly damaging 0.94
IGL03010:Haus3 APN 5 34166287 missense probably benign 0.04
IGL03371:Haus3 APN 5 34166343 nonsense probably null
R0102:Haus3 UTSW 5 34165914 critical splice donor site probably null
R0102:Haus3 UTSW 5 34165914 critical splice donor site probably null
R0238:Haus3 UTSW 5 34166256 missense possibly damaging 0.54
R0238:Haus3 UTSW 5 34166256 missense possibly damaging 0.54
R0701:Haus3 UTSW 5 34166015 missense probably benign 0.05
R1714:Haus3 UTSW 5 34163697 missense probably benign 0.03
R1800:Haus3 UTSW 5 34163572 missense probably damaging 1.00
R4874:Haus3 UTSW 5 34167628 missense probably benign 0.07
R4895:Haus3 UTSW 5 34168070 missense probably benign 0.33
R5268:Haus3 UTSW 5 34166105 missense probably damaging 0.98
R5613:Haus3 UTSW 5 34167829 missense probably damaging 0.98
R6299:Haus3 UTSW 5 34167796 missense probably benign 0.40
R6701:Haus3 UTSW 5 34167734 missense probably damaging 0.99
R7414:Haus3 UTSW 5 34166133 missense probably benign
X0019:Haus3 UTSW 5 34163556 nonsense probably null
X0063:Haus3 UTSW 5 34166222 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ACACAGCAGGCATAGTAAATATTCCGTT -3'
(R):5'- TGAAGACATGGAACAGATCAGGTACACT -3'

Sequencing Primer
(F):5'- ATTCCGTTTTTAGAACTCTTCAGTC -3'
(R):5'- gcacctttatccactgagcc -3'
Posted On2014-04-13