Incidental Mutation 'R1527:Ugt2a3'
ID166280
Institutional Source Beutler Lab
Gene Symbol Ugt2a3
Ensembl Gene ENSMUSG00000035780
Gene NameUDP glucuronosyltransferase 2 family, polypeptide A3
Synonyms2010321J07Rik
MMRRC Submission 039567-MU
Accession Numbers

Genbank: NM_028094; MGI: 1919344

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1527 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87324972-87337195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87325598 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 487 (Q487K)
Ref Sequence ENSEMBL: ENSMUSP00000031195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031195]
Predicted Effect probably damaging
Transcript: ENSMUST00000031195
AA Change: Q487K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031195
Gene: ENSMUSG00000035780
AA Change: Q487K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:UDPGT 24 526 1.2e-233 PFAM
Pfam:Glyco_tran_28_C 318 454 1.5e-10 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Ugt2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ugt2a3 APN 5 87325655 missense probably damaging 0.99
IGL00542:Ugt2a3 APN 5 87336823 missense possibly damaging 0.61
IGL01335:Ugt2a3 APN 5 87336785 missense probably damaging 1.00
IGL01369:Ugt2a3 APN 5 87327120 missense probably damaging 1.00
IGL01808:Ugt2a3 APN 5 87325555 missense probably benign 0.09
IGL02380:Ugt2a3 APN 5 87336799 missense probably benign 0.09
IGL03245:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03260:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03261:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03280:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03302:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
D4186:Ugt2a3 UTSW 5 87329613 missense probably damaging 1.00
R0051:Ugt2a3 UTSW 5 87337006 missense probably damaging 1.00
R0103:Ugt2a3 UTSW 5 87336718 missense possibly damaging 0.89
R0103:Ugt2a3 UTSW 5 87336718 missense possibly damaging 0.89
R0324:Ugt2a3 UTSW 5 87327073 critical splice donor site probably null
R0401:Ugt2a3 UTSW 5 87336490 missense probably benign 0.03
R0506:Ugt2a3 UTSW 5 87336649 missense possibly damaging 0.78
R0903:Ugt2a3 UTSW 5 87327711 missense probably benign 0.00
R0940:Ugt2a3 UTSW 5 87327206 missense possibly damaging 0.95
R1121:Ugt2a3 UTSW 5 87327689 missense probably damaging 0.99
R1296:Ugt2a3 UTSW 5 87327146 missense probably damaging 0.96
R2104:Ugt2a3 UTSW 5 87329682 splice site probably null
R2119:Ugt2a3 UTSW 5 87336571 missense probably damaging 0.98
R2374:Ugt2a3 UTSW 5 87327191 missense probably damaging 1.00
R3082:Ugt2a3 UTSW 5 87325675 missense probably benign 0.05
R3853:Ugt2a3 UTSW 5 87337159 missense possibly damaging 0.74
R3894:Ugt2a3 UTSW 5 87329590 missense probably benign 0.09
R4063:Ugt2a3 UTSW 5 87336866 missense probably benign 0.04
R4274:Ugt2a3 UTSW 5 87327689 missense probably damaging 0.99
R4739:Ugt2a3 UTSW 5 87327195 missense probably damaging 0.97
R4879:Ugt2a3 UTSW 5 87331285 missense probably benign 0.06
R5327:Ugt2a3 UTSW 5 87331315 missense probably damaging 1.00
R5508:Ugt2a3 UTSW 5 87327200 missense probably damaging 0.98
R5866:Ugt2a3 UTSW 5 87336547 missense probably damaging 1.00
R6026:Ugt2a3 UTSW 5 87336477 missense probably benign 0.00
R6268:Ugt2a3 UTSW 5 87329613 missense probably damaging 1.00
R6807:Ugt2a3 UTSW 5 87336758 missense probably benign 0.00
R6980:Ugt2a3 UTSW 5 87325632 missense probably damaging 1.00
R7056:Ugt2a3 UTSW 5 87337094 missense probably damaging 0.98
R7133:Ugt2a3 UTSW 5 87325534 missense possibly damaging 0.61
R7477:Ugt2a3 UTSW 5 87336620 missense possibly damaging 0.90
R7485:Ugt2a3 UTSW 5 87327680 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTCACTCAGGGCTTTCCCAAAC -3'
(R):5'- AGTAGGGCTCCCAACACATCAAGG -3'

Sequencing Primer
(F):5'- GGCTTTCCCAAACCTAAAAAAGAC -3'
(R):5'- ACAGTCTTGGGCACTATAGC -3'
Posted On2014-04-13