Incidental Mutation 'R1527:Olfr822'
ID166297
Institutional Source Beutler Lab
Gene Symbol Olfr822
Ensembl Gene ENSMUSG00000058251
Gene Nameolfactory receptor 822
SynonymsMOR113-2, GA_x6K02T2PULF-11745102-11746040
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1527 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location130071210-130076909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130075192 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 261 (S261T)
Ref Sequence ENSEMBL: ENSMUSP00000150652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080460] [ENSMUST00000216879]
Predicted Effect probably damaging
Transcript: ENSMUST00000080460
AA Change: S261T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079316
Gene: ENSMUSG00000058251
AA Change: S261T

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.1e-49 PFAM
Pfam:7tm_1 39 288 9.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216879
AA Change: S261T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Olfr822
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Olfr822 APN 10 130074650 missense probably damaging 1.00
IGL01975:Olfr822 APN 10 130075270 missense probably damaging 1.00
IGL02354:Olfr822 APN 10 130075274 missense probably damaging 1.00
IGL02361:Olfr822 APN 10 130075274 missense probably damaging 1.00
IGL03184:Olfr822 APN 10 130074758 missense possibly damaging 0.82
IGL03197:Olfr822 APN 10 130074679 missense probably damaging 0.99
IGL03343:Olfr822 APN 10 130075256 missense probably damaging 1.00
R0310:Olfr822 UTSW 10 130074823 missense probably benign 0.00
R1288:Olfr822 UTSW 10 130075285 missense probably damaging 1.00
R1502:Olfr822 UTSW 10 130074872 missense probably damaging 0.97
R3771:Olfr822 UTSW 10 130075274 missense probably damaging 1.00
R5022:Olfr822 UTSW 10 130074593 missense probably damaging 1.00
R5472:Olfr822 UTSW 10 130075029 missense probably damaging 0.97
R5552:Olfr822 UTSW 10 130075145 missense probably damaging 0.99
R6451:Olfr822 UTSW 10 130075138 missense probably benign 0.01
R6986:Olfr822 UTSW 10 130075330 missense possibly damaging 0.63
X0024:Olfr822 UTSW 10 130074725 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGCACTGACACACAGCTCATAGA -3'
(R):5'- CTGGACATCAAAACCAGTCCCTTTGTA -3'

Sequencing Primer
(F):5'- GAGACAATTGCATTCATCTCAGC -3'
(R):5'- TTGGAGATGTGAAAATGaacaaaaac -3'
Posted On2014-04-13