Incidental Mutation 'R1527:Cacna1d'
ID166305
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Namecalcium channel, voltage-dependent, L type, alpha 1D subunit
SynonymsC79217, Cchl1a2, Cav1.3alpha1, Cchl1a, Cacnl1a2, D-LTCC, 8430418G19Rik
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.674) question?
Stock #R1527 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30039939-30491455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30107796 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 954 (I954T)
Ref Sequence ENSEMBL: ENSMUSP00000153250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
Predicted Effect probably damaging
Transcript: ENSMUST00000112249
AA Change: I934T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968
AA Change: I934T

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112250
AA Change: I956T

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: I956T

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223803
AA Change: I934T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224198
AA Change: I954T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224395
Predicted Effect probably damaging
Transcript: ENSMUST00000224785
AA Change: I934T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 30096950 missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30350681 missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 30051742 splice site probably benign
IGL01420:Cacna1d APN 14 30051638 missense probably benign 0.01
IGL01470:Cacna1d APN 14 30099142 missense probably damaging 0.99
IGL01560:Cacna1d APN 14 30099206 missense probably benign 0.00
IGL01617:Cacna1d APN 14 30102371 missense probably damaging 1.00
IGL01820:Cacna1d APN 14 30042866 missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 30124794 missense probably damaging 1.00
IGL02702:Cacna1d APN 14 30123533 nonsense probably null
IGL02864:Cacna1d APN 14 30051706 missense probably benign 0.10
IGL03082:Cacna1d APN 14 30099233 missense probably damaging 1.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0033:Cacna1d UTSW 14 30105489 missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0284:Cacna1d UTSW 14 30072105 missense probably damaging 1.00
R0416:Cacna1d UTSW 14 30100688 splice site probably benign
R0427:Cacna1d UTSW 14 30346817 missense probably damaging 0.99
R0517:Cacna1d UTSW 14 30179275 missense probably damaging 1.00
R0639:Cacna1d UTSW 14 30171294 critical splice donor site probably null
R0727:Cacna1d UTSW 14 30130115 critical splice donor site probably null
R0732:Cacna1d UTSW 14 30042920 missense probably damaging 0.99
R0843:Cacna1d UTSW 14 30124871 missense probably damaging 1.00
R0900:Cacna1d UTSW 14 30111082 missense probably damaging 1.00
R1278:Cacna1d UTSW 14 30178703 missense probably damaging 1.00
R1340:Cacna1d UTSW 14 30072067 missense probably damaging 0.96
R1711:Cacna1d UTSW 14 30066056 missense probably damaging 1.00
R1736:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R1763:Cacna1d UTSW 14 30099196 missense probably benign 0.25
R2034:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R2086:Cacna1d UTSW 14 30047357 missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 30123163 missense probably damaging 1.00
R2218:Cacna1d UTSW 14 30123091 missense probably damaging 1.00
R2219:Cacna1d UTSW 14 30042090 missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30491016 missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 30042342 missense probably damaging 1.00
R2399:Cacna1d UTSW 14 30052487 missense probably benign 0.34
R2424:Cacna1d UTSW 14 30049023 missense probably damaging 0.96
R2568:Cacna1d UTSW 14 30082511 missense probably damaging 0.99
R4038:Cacna1d UTSW 14 30066083 missense probably damaging 0.96
R4509:Cacna1d UTSW 14 30096971 missense probably damaging 1.00
R4649:Cacna1d UTSW 14 30095408 missense probably benign
R4650:Cacna1d UTSW 14 30095408 missense probably benign
R4652:Cacna1d UTSW 14 30095408 missense probably benign
R5009:Cacna1d UTSW 14 30079332 missense probably damaging 1.00
R5058:Cacna1d UTSW 14 30114244 nonsense probably null
R5063:Cacna1d UTSW 14 30051383 missense probably benign
R5138:Cacna1d UTSW 14 30490972 missense probably benign
R5151:Cacna1d UTSW 14 30123323 missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30352924 critical splice donor site probably null
R5286:Cacna1d UTSW 14 30350725 missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30346841 missense probably benign 0.38
R5383:Cacna1d UTSW 14 30045279 missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 30100751 missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30350833 nonsense probably null
R5524:Cacna1d UTSW 14 30042129 missense probably benign 0.01
R5663:Cacna1d UTSW 14 30123340 missense probably damaging 1.00
R5712:Cacna1d UTSW 14 30074997 missense probably damaging 1.00
R5796:Cacna1d UTSW 14 30066116 missense probably damaging 1.00
R5906:Cacna1d UTSW 14 30096960 missense probably damaging 1.00
R5923:Cacna1d UTSW 14 30111148 missense probably damaging 1.00
R5936:Cacna1d UTSW 14 30171314 missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 30103735 missense probably damaging 1.00
R6041:Cacna1d UTSW 14 30042357 missense probably damaging 1.00
R6432:Cacna1d UTSW 14 30123454 missense probably damaging 1.00
R6486:Cacna1d UTSW 14 30114233 missense probably benign 0.01
R6600:Cacna1d UTSW 14 30114235 missense probably benign 0.15
R6661:Cacna1d UTSW 14 30089875 missense probably damaging 1.00
R6753:Cacna1d UTSW 14 30042786 missense probably damaging 1.00
R6804:Cacna1d UTSW 14 30051665 missense probably benign 0.00
R6851:Cacna1d UTSW 14 30042782 missense probably damaging 1.00
R6863:Cacna1d UTSW 14 30075852 missense probably damaging 1.00
R6916:Cacna1d UTSW 14 30095364 missense probably damaging 1.00
R6925:Cacna1d UTSW 14 30051637 missense probably benign
R7066:Cacna1d UTSW 14 30352978 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCTCAAAGCACTTCACGCATCTCTC -3'
(R):5'- CATTCCTTGGTGGTTGCAAAGACG -3'

Sequencing Primer
(F):5'- GCATCTCTCCTGTGCTTGAAG -3'
(R):5'- GGTCCTTCTGAGTGTCTCAGC -3'
Posted On2014-04-13