Incidental Mutation 'R1528:Ercc5'
ID166318
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 5
SynonymsXpg
MMRRC Submission 039568-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1528 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location44147744-44181260 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 44178241 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 915 (K915*)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
Predicted Effect probably null
Transcript: ENSMUST00000027214
AA Change: K915*
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: K915*

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131177
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,067,696 Q262L possibly damaging Het
4921501E09Rik A G 17: 33,067,241 S196P probably damaging Het
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Abcg4 T C 9: 44,274,723 Y617C probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ano1 T G 7: 144,595,566 S853R probably damaging Het
Ap4e1 T A 2: 127,011,823 S60R possibly damaging Het
Atp4b C A 8: 13,389,693 K176N possibly damaging Het
Atxn2 A T 5: 121,802,108 D982V probably damaging Het
Atxn2 T C 5: 121,813,530 F646S probably damaging Het
Bcl2l13 T C 6: 120,870,794 C136R possibly damaging Het
Cacna1i A G 15: 80,391,774 probably null Het
Ccdc122 T A 14: 77,067,939 V11D possibly damaging Het
Cdnf A G 2: 3,521,041 D90G probably damaging Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Chmp6 A G 11: 119,916,715 D128G probably benign Het
Clec18a A T 8: 111,078,866 M201K probably benign Het
Col11a1 A T 3: 114,216,995 probably benign Het
Col6a4 A T 9: 106,075,220 M493K probably damaging Het
Crygd A C 1: 65,063,057 probably null Het
Dennd1c T C 17: 57,066,935 T543A probably benign Het
Erbb4 A T 1: 68,078,582 C891* probably null Het
Ercc6 A T 14: 32,519,022 N168Y probably damaging Het
Esrp2 G T 8: 106,136,752 P6T unknown Het
Exoc1 A G 5: 76,549,564 K396R possibly damaging Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Fgf7 T A 2: 126,035,818 M35K probably damaging Het
Fras1 G A 5: 96,636,819 G887D probably damaging Het
Fuk A T 8: 110,883,241 L1047Q probably damaging Het
Gbp4 A T 5: 105,121,792 probably null Het
Homez A T 14: 54,857,705 M182K probably benign Het
Hrnr G A 3: 93,322,794 S113N possibly damaging Het
Ifit3b T G 19: 34,611,672 S83A probably benign Het
Ildr2 A G 1: 166,270,495 probably null Het
Klhdc1 A T 12: 69,263,198 R291S probably benign Het
Krt77 T A 15: 101,861,088 I413F probably damaging Het
Lipn A G 19: 34,068,670 I14M probably damaging Het
Macf1 T G 4: 123,476,014 R86S probably benign Het
Mroh8 C A 2: 157,230,055 G510V probably damaging Het
Mycbp2 A T 14: 103,232,597 D1255E possibly damaging Het
Nckap5 C T 1: 126,024,922 V1234I possibly damaging Het
Nlrp9c T C 7: 26,382,298 K668E probably damaging Het
Nod2 T C 8: 88,664,589 M508T possibly damaging Het
Npffr1 A G 10: 61,614,237 M97V possibly damaging Het
Nsd3 G A 8: 25,698,767 V43M probably damaging Het
Nubp2 A G 17: 24,884,414 V163A probably damaging Het
Oas1e A T 5: 120,787,989 F338Y probably damaging Het
Oat C A 7: 132,564,269 G196C probably damaging Het
Olfr1241 C T 2: 89,482,553 G194D probably damaging Het
Olfr57 T C 10: 79,035,564 L256P probably damaging Het
Olfr675 A T 7: 105,024,764 L72Q probably damaging Het
P2ry13 T C 3: 59,210,289 T23A probably benign Het
Pja2 C A 17: 64,309,222 S226I possibly damaging Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Plekhs1 T C 19: 56,479,995 S332P probably damaging Het
Polr3e T A 7: 120,940,597 N522K probably damaging Het
Prdm10 A G 9: 31,357,286 T844A probably damaging Het
Ripk1 C T 13: 34,028,147 P480L probably benign Het
Rnf139 T C 15: 58,899,215 V363A probably damaging Het
Rnf19a A T 15: 36,265,655 S99T possibly damaging Het
Rnf224 G A 2: 25,236,098 T81I probably benign Het
Rpgrip1 T C 14: 52,112,224 L23S probably benign Het
Setd5 T A 6: 113,121,738 F758L probably damaging Het
Smlr1 C A 10: 25,536,078 V4L possibly damaging Het
Snx1 T C 9: 66,109,543 D34G probably damaging Het
Spaca5 A T X: 21,076,653 T92S probably benign Het
Speer4f2 A G 5: 17,376,542 T161A possibly damaging Het
Swi5 C A 2: 32,280,704 probably null Het
Syne2 T A 12: 75,966,100 D2689E probably benign Het
Tcof1 T A 18: 60,814,999 K1299* probably null Het
Tmprss11e G A 5: 86,724,210 T49I probably damaging Het
Tmx3 T A 18: 90,537,086 V309D possibly damaging Het
Trim30b C G 7: 104,357,299 V117L possibly damaging Het
Tsen2 C A 6: 115,560,028 H248Q probably benign Het
Ttn T C 2: 76,737,068 Y19500C probably damaging Het
Tubgcp2 A G 7: 140,033,783 probably benign Het
Vwf A C 6: 125,608,291 D712A possibly damaging Het
Wfdc2 A G 2: 164,565,908 K166E probably damaging Het
Xrcc2 T C 5: 25,692,294 D219G probably benign Het
Zc3h6 C T 2: 129,017,069 P1007S probably benign Het
Zdhhc17 A T 10: 110,948,189 probably null Het
Zfp369 T A 13: 65,292,165 I221N probably damaging Het
Zfp655 A T 5: 145,244,601 N423I probably damaging Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R2680:Ercc5 UTSW 1 44156973 missense probably benign 0.09
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4578:Ercc5 UTSW 1 44148148 missense probably benign 0.32
R4585:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4586:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44157057 missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44175965 missense probably benign 0.09
R5155:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6161:Ercc5 UTSW 1 44167352 missense probably benign 0.00
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense not run
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAGGAGCTGTAGGAGTTTGTCATC -3'
(R):5'- TCATTCCCCAGCACTGGGAAATAAC -3'

Sequencing Primer
(F):5'- AGTTTGTCATCTGAGATTCTAGTCC -3'
(R):5'- gtaaaggcgtggcccag -3'
Posted On2014-04-13