Incidental Mutation 'R1528:Fras1'
ID166345
Institutional Source Beutler Lab
Gene Symbol Fras1
Ensembl Gene ENSMUSG00000034687
Gene NameFraser extracellular matrix complex subunit 1
Synonymsbl, E130113P14Rik
MMRRC Submission 039568-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1528 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location96373955-96784728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96636819 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 887 (G887D)
Ref Sequence ENSEMBL: ENSMUSP00000043250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036019]
Predicted Effect probably damaging
Transcript: ENSMUST00000036019
AA Change: G887D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043250
Gene: ENSMUSG00000034687
AA Change: G887D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 27 86 9.23e-9 SMART
VWC 94 151 9.37e-10 SMART
VWC 158 215 8.61e-9 SMART
VWC 220 277 7.1e-10 SMART
VWC 284 341 7.8e-7 SMART
VWC 365 415 1.93e-1 SMART
FU 408 459 3.33e-1 SMART
FU 461 504 9.12e-8 SMART
EGF_like 466 495 6.67e1 SMART
FU 506 552 6.01e-8 SMART
FU 554 598 2.21e-6 SMART
FU 601 646 1.28e-11 SMART
FU 648 704 4.19e-7 SMART
FU 707 752 9.12e-8 SMART
FU 754 799 1.11e-6 SMART
EGF_like 759 790 7.23e1 SMART
FU 802 851 5.44e-6 SMART
EGF_like 807 842 4.55e1 SMART
FU 853 899 7.4e-8 SMART
FU 902 947 4.78e-2 SMART
FU 951 996 4.52e-12 SMART
EGF_like 956 987 2.75e1 SMART
FU 998 1041 1.38e-7 SMART
FU 1045 1088 9.7e-3 SMART
EGF_like 1057 1096 3.16e1 SMART
Pfam:Cadherin_3 1098 1198 5.2e-12 PFAM
Pfam:Cadherin_3 1167 1309 6.5e-27 PFAM
Pfam:Cadherin_3 1278 1442 7e-24 PFAM
Pfam:Cadherin_3 1411 1560 1.3e-23 PFAM
Pfam:Cadherin_3 1561 1693 6.4e-15 PFAM
Pfam:Cadherin_3 1695 1814 1.1e-10 PFAM
Pfam:Cadherin_3 1780 1940 1.6e-18 PFAM
Pfam:Cadherin_3 1906 2061 2.8e-22 PFAM
Pfam:Cadherin_3 2063 2181 3.3e-18 PFAM
Pfam:Cadherin_3 2172 2295 1.4e-26 PFAM
Pfam:Cadherin_3 2296 2408 2.3e-31 PFAM
Pfam:Cadherin_3 2413 2540 7.9e-23 PFAM
Calx_beta 2544 2648 1.23e-10 SMART
Calx_beta 2661 2772 3.3e-11 SMART
Calx_beta 2787 2892 1.21e-9 SMART
Calx_beta 2907 3009 4.45e-3 SMART
Calx_beta 3027 3131 1.5e-14 SMART
Blast:Calx_beta 3162 3187 1e-5 BLAST
transmembrane domain 3902 3924 N/A INTRINSIC
low complexity region 3927 3935 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199204
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein that appears to function in the regulation of epidermal-basement membrane adhesion and organogenesis during development. Mutations in this gene cause Fraser syndrome, a multisystem malformation that can include craniofacial, urogenital and respiratory system abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Survival is variable on genetic backgrounds. Kidney development is severely affected and syndactyly is common. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,067,696 Q262L possibly damaging Het
4921501E09Rik A G 17: 33,067,241 S196P probably damaging Het
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Abcg4 T C 9: 44,274,723 Y617C probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ano1 T G 7: 144,595,566 S853R probably damaging Het
Ap4e1 T A 2: 127,011,823 S60R possibly damaging Het
Atp4b C A 8: 13,389,693 K176N possibly damaging Het
Atxn2 A T 5: 121,802,108 D982V probably damaging Het
Atxn2 T C 5: 121,813,530 F646S probably damaging Het
Bcl2l13 T C 6: 120,870,794 C136R possibly damaging Het
Cacna1i A G 15: 80,391,774 probably null Het
Ccdc122 T A 14: 77,067,939 V11D possibly damaging Het
Cdnf A G 2: 3,521,041 D90G probably damaging Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Chmp6 A G 11: 119,916,715 D128G probably benign Het
Clec18a A T 8: 111,078,866 M201K probably benign Het
Col11a1 A T 3: 114,216,995 probably benign Het
Col6a4 A T 9: 106,075,220 M493K probably damaging Het
Crygd A C 1: 65,063,057 probably null Het
Dennd1c T C 17: 57,066,935 T543A probably benign Het
Erbb4 A T 1: 68,078,582 C891* probably null Het
Ercc5 A T 1: 44,178,241 K915* probably null Het
Ercc6 A T 14: 32,519,022 N168Y probably damaging Het
Esrp2 G T 8: 106,136,752 P6T unknown Het
Exoc1 A G 5: 76,549,564 K396R possibly damaging Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Fgf7 T A 2: 126,035,818 M35K probably damaging Het
Fuk A T 8: 110,883,241 L1047Q probably damaging Het
Gbp4 A T 5: 105,121,792 probably null Het
Homez A T 14: 54,857,705 M182K probably benign Het
Hrnr G A 3: 93,322,794 S113N possibly damaging Het
Ifit3b T G 19: 34,611,672 S83A probably benign Het
Ildr2 A G 1: 166,270,495 probably null Het
Klhdc1 A T 12: 69,263,198 R291S probably benign Het
Krt77 T A 15: 101,861,088 I413F probably damaging Het
Lipn A G 19: 34,068,670 I14M probably damaging Het
Macf1 T G 4: 123,476,014 R86S probably benign Het
Mroh8 C A 2: 157,230,055 G510V probably damaging Het
Mycbp2 A T 14: 103,232,597 D1255E possibly damaging Het
Nckap5 C T 1: 126,024,922 V1234I possibly damaging Het
Nlrp9c T C 7: 26,382,298 K668E probably damaging Het
Nod2 T C 8: 88,664,589 M508T possibly damaging Het
Npffr1 A G 10: 61,614,237 M97V possibly damaging Het
Nsd3 G A 8: 25,698,767 V43M probably damaging Het
Nubp2 A G 17: 24,884,414 V163A probably damaging Het
Oas1e A T 5: 120,787,989 F338Y probably damaging Het
Oat C A 7: 132,564,269 G196C probably damaging Het
Olfr1241 C T 2: 89,482,553 G194D probably damaging Het
Olfr57 T C 10: 79,035,564 L256P probably damaging Het
Olfr675 A T 7: 105,024,764 L72Q probably damaging Het
P2ry13 T C 3: 59,210,289 T23A probably benign Het
Pja2 C A 17: 64,309,222 S226I possibly damaging Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Plekhs1 T C 19: 56,479,995 S332P probably damaging Het
Polr3e T A 7: 120,940,597 N522K probably damaging Het
Prdm10 A G 9: 31,357,286 T844A probably damaging Het
Ripk1 C T 13: 34,028,147 P480L probably benign Het
Rnf139 T C 15: 58,899,215 V363A probably damaging Het
Rnf19a A T 15: 36,265,655 S99T possibly damaging Het
Rnf224 G A 2: 25,236,098 T81I probably benign Het
Rpgrip1 T C 14: 52,112,224 L23S probably benign Het
Setd5 T A 6: 113,121,738 F758L probably damaging Het
Smlr1 C A 10: 25,536,078 V4L possibly damaging Het
Snx1 T C 9: 66,109,543 D34G probably damaging Het
Spaca5 A T X: 21,076,653 T92S probably benign Het
Speer4f2 A G 5: 17,376,542 T161A possibly damaging Het
Swi5 C A 2: 32,280,704 probably null Het
Syne2 T A 12: 75,966,100 D2689E probably benign Het
Tcof1 T A 18: 60,814,999 K1299* probably null Het
Tmprss11e G A 5: 86,724,210 T49I probably damaging Het
Tmx3 T A 18: 90,537,086 V309D possibly damaging Het
Trim30b C G 7: 104,357,299 V117L possibly damaging Het
Tsen2 C A 6: 115,560,028 H248Q probably benign Het
Ttn T C 2: 76,737,068 Y19500C probably damaging Het
Tubgcp2 A G 7: 140,033,783 probably benign Het
Vwf A C 6: 125,608,291 D712A possibly damaging Het
Wfdc2 A G 2: 164,565,908 K166E probably damaging Het
Xrcc2 T C 5: 25,692,294 D219G probably benign Het
Zc3h6 C T 2: 129,017,069 P1007S probably benign Het
Zdhhc17 A T 10: 110,948,189 probably null Het
Zfp369 T A 13: 65,292,165 I221N probably damaging Het
Zfp655 A T 5: 145,244,601 N423I probably damaging Het
Other mutations in Fras1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fras1 APN 5 96739358 missense possibly damaging 0.55
IGL00507:Fras1 APN 5 96778189 missense probably damaging 1.00
IGL00672:Fras1 APN 5 96759450 splice site probably benign
IGL00772:Fras1 APN 5 96636112 missense probably benign 0.42
IGL00844:Fras1 APN 5 96534853 splice site probably benign
IGL00913:Fras1 APN 5 96695076 missense probably damaging 0.99
IGL00959:Fras1 APN 5 96781281 missense probably damaging 0.96
IGL00966:Fras1 APN 5 96555221 missense probably benign 0.00
IGL01296:Fras1 APN 5 96673698 missense probably null 0.58
IGL01307:Fras1 APN 5 96781692 missense probably benign
IGL01481:Fras1 APN 5 96657241 missense probably damaging 1.00
IGL01525:Fras1 APN 5 96739336 missense probably damaging 0.99
IGL01599:Fras1 APN 5 96709891 missense possibly damaging 0.94
IGL01646:Fras1 APN 5 96758148 missense probably benign 0.29
IGL01795:Fras1 APN 5 96778045 missense probably damaging 1.00
IGL01867:Fras1 APN 5 96588131 missense probably benign
IGL01869:Fras1 APN 5 96708783 splice site probably benign
IGL01923:Fras1 APN 5 96735280 missense probably damaging 1.00
IGL01982:Fras1 APN 5 96739248 missense possibly damaging 0.46
IGL02109:Fras1 APN 5 96700523 missense probably benign
IGL02132:Fras1 APN 5 96781637 nonsense probably null
IGL02171:Fras1 APN 5 96735181 missense probably benign 0.15
IGL02213:Fras1 APN 5 96645871 nonsense probably null
IGL02277:Fras1 APN 5 96588118 missense probably benign 0.00
IGL02507:Fras1 APN 5 96657408 missense possibly damaging 0.95
IGL02589:Fras1 APN 5 96769513 missense probably damaging 1.00
IGL02671:Fras1 APN 5 96728616 missense possibly damaging 0.91
IGL02677:Fras1 APN 5 96545024 missense probably damaging 1.00
IGL02691:Fras1 APN 5 96744705 missense possibly damaging 0.68
IGL02741:Fras1 APN 5 96691371 missense probably benign 0.35
IGL02836:Fras1 APN 5 96534866 missense possibly damaging 0.67
IGL02850:Fras1 APN 5 96778175 missense probably damaging 1.00
IGL02998:Fras1 APN 5 96702181 missense possibly damaging 0.82
IGL03040:Fras1 APN 5 96710101 missense probably benign
IGL03078:Fras1 APN 5 96636135 missense probably damaging 1.00
IGL03096:Fras1 APN 5 96764901 missense probably damaging 1.00
IGL03102:Fras1 APN 5 96726535 missense probably benign 0.11
IGL03183:Fras1 APN 5 96733781 splice site probably benign
IGL03189:Fras1 APN 5 96743071 missense probably benign 0.00
IGL03193:Fras1 APN 5 96778106 missense probably damaging 0.99
IGL03292:Fras1 APN 5 96707491 missense probably damaging 1.00
IGL03328:Fras1 APN 5 96781760 missense probably damaging 0.96
IGL03335:Fras1 APN 5 96733944 splice site probably benign
IGL03394:Fras1 APN 5 96667477 missense probably damaging 0.98
IGL03404:Fras1 APN 5 96728581 missense probably damaging 0.99
baby_ruth UTSW 5 96708758 missense probably benign 0.01
I0000:Fras1 UTSW 5 96740829 missense probably damaging 0.99
R0028:Fras1 UTSW 5 96677316 missense probably benign 0.07
R0049:Fras1 UTSW 5 96776622 missense probably benign 0.07
R0049:Fras1 UTSW 5 96776622 missense probably benign 0.07
R0099:Fras1 UTSW 5 96614917 critical splice donor site probably null
R0109:Fras1 UTSW 5 96710077 missense probably benign 0.01
R0158:Fras1 UTSW 5 96776634 missense possibly damaging 0.83
R0268:Fras1 UTSW 5 96737009 missense probably damaging 0.99
R0305:Fras1 UTSW 5 96596888 missense probably benign
R0352:Fras1 UTSW 5 96726540 missense probably damaging 0.97
R0359:Fras1 UTSW 5 96762590 missense probably damaging 0.98
R0371:Fras1 UTSW 5 96555331 missense possibly damaging 0.90
R0379:Fras1 UTSW 5 96755509 nonsense probably null
R0395:Fras1 UTSW 5 96769653 missense possibly damaging 0.50
R0417:Fras1 UTSW 5 96691372 missense probably benign 0.18
R0454:Fras1 UTSW 5 96762665 missense probably damaging 0.96
R0456:Fras1 UTSW 5 96554788 missense probably damaging 1.00
R0456:Fras1 UTSW 5 96714343 splice site probably null
R0464:Fras1 UTSW 5 96636803 missense probably damaging 0.98
R0613:Fras1 UTSW 5 96700488 splice site probably benign
R0652:Fras1 UTSW 5 96781340 missense possibly damaging 0.91
R0675:Fras1 UTSW 5 96667387 splice site probably benign
R0765:Fras1 UTSW 5 96552796 missense probably benign 0.00
R0783:Fras1 UTSW 5 96768430 missense probably damaging 1.00
R0811:Fras1 UTSW 5 96752998 missense probably benign 0.35
R0812:Fras1 UTSW 5 96752998 missense probably benign 0.35
R0943:Fras1 UTSW 5 96726543 missense probably benign 0.00
R1037:Fras1 UTSW 5 96714463 missense probably damaging 0.97
R1104:Fras1 UTSW 5 96708671 missense probably benign 0.00
R1108:Fras1 UTSW 5 96642629 missense probably damaging 0.99
R1332:Fras1 UTSW 5 96707308 missense probably benign 0.00
R1336:Fras1 UTSW 5 96707308 missense probably benign 0.00
R1458:Fras1 UTSW 5 96600733 missense probably benign 0.00
R1495:Fras1 UTSW 5 96528586 missense possibly damaging 0.49
R1499:Fras1 UTSW 5 96743187 missense probably benign 0.31
R1532:Fras1 UTSW 5 96713996 missense probably damaging 1.00
R1556:Fras1 UTSW 5 96743062 missense possibly damaging 0.88
R1625:Fras1 UTSW 5 96709978 missense possibly damaging 0.94
R1625:Fras1 UTSW 5 96713990 missense probably damaging 1.00
R1645:Fras1 UTSW 5 96700586 missense possibly damaging 0.90
R1647:Fras1 UTSW 5 96726613 critical splice donor site probably null
R1648:Fras1 UTSW 5 96726613 critical splice donor site probably null
R1661:Fras1 UTSW 5 96598909 missense probably damaging 1.00
R1665:Fras1 UTSW 5 96598909 missense probably damaging 1.00
R1682:Fras1 UTSW 5 96645873 missense probably benign 0.00
R1701:Fras1 UTSW 5 96600784 missense probably benign 0.00
R1716:Fras1 UTSW 5 96552725 missense probably benign 0.10
R1718:Fras1 UTSW 5 96554889 splice site probably null
R1800:Fras1 UTSW 5 96709882 missense probably benign
R1806:Fras1 UTSW 5 96713970 splice site probably benign
R1806:Fras1 UTSW 5 96764976 missense possibly damaging 0.88
R1822:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1823:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1824:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1847:Fras1 UTSW 5 96749423 intron probably null
R1929:Fras1 UTSW 5 96667437 missense probably benign 0.24
R1951:Fras1 UTSW 5 96712383 missense probably benign 0.38
R2093:Fras1 UTSW 5 96781203 missense probably damaging 1.00
R2283:Fras1 UTSW 5 96654305 missense probably benign 0.10
R2884:Fras1 UTSW 5 96700268 missense probably benign 0.07
R2913:Fras1 UTSW 5 96733915 missense probably benign
R2914:Fras1 UTSW 5 96733915 missense probably benign
R3054:Fras1 UTSW 5 96764943 missense probably damaging 0.99
R3117:Fras1 UTSW 5 96771712 missense probably damaging 1.00
R3118:Fras1 UTSW 5 96771712 missense probably damaging 1.00
R3691:Fras1 UTSW 5 96781512 missense probably benign 0.02
R3714:Fras1 UTSW 5 96645970 critical splice donor site probably null
R3715:Fras1 UTSW 5 96645970 critical splice donor site probably null
R3801:Fras1 UTSW 5 96733932 missense probably benign 0.26
R3961:Fras1 UTSW 5 96677385 critical splice donor site probably null
R4065:Fras1 UTSW 5 96770683 missense possibly damaging 0.64
R4066:Fras1 UTSW 5 96770683 missense possibly damaging 0.64
R4076:Fras1 UTSW 5 96743158 missense probably damaging 1.00
R4124:Fras1 UTSW 5 96770653 missense probably benign 0.05
R4127:Fras1 UTSW 5 96770653 missense probably benign 0.05
R4153:Fras1 UTSW 5 96776735 missense probably benign 0.17
R4233:Fras1 UTSW 5 96714376 missense possibly damaging 0.91
R4273:Fras1 UTSW 5 96614904 missense probably benign 0.00
R4355:Fras1 UTSW 5 96700242 missense probably benign
R4401:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4402:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4403:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4505:Fras1 UTSW 5 96781348 missense probably damaging 1.00
R4548:Fras1 UTSW 5 96709895 missense probably benign 0.00
R4559:Fras1 UTSW 5 96781289 missense probably damaging 1.00
R4629:Fras1 UTSW 5 96776734 missense probably benign 0.00
R4637:Fras1 UTSW 5 96778088 missense probably damaging 1.00
R4678:Fras1 UTSW 5 96700568 missense probably benign 0.13
R4707:Fras1 UTSW 5 96735238 missense probably damaging 0.96
R4735:Fras1 UTSW 5 96588163 missense probably benign 0.00
R4756:Fras1 UTSW 5 96781659 missense probably benign 0.00
R4762:Fras1 UTSW 5 96731618 missense probably benign
R4820:Fras1 UTSW 5 96728653 missense probably benign 0.00
R4847:Fras1 UTSW 5 96544992 missense possibly damaging 0.94
R4857:Fras1 UTSW 5 96778159 missense probably benign 0.00
R4909:Fras1 UTSW 5 96708758 missense probably benign 0.01
R4931:Fras1 UTSW 5 96636840 missense probably benign 0.02
R4938:Fras1 UTSW 5 96776724 missense probably damaging 0.99
R4952:Fras1 UTSW 5 96647498 missense probably benign 0.01
R4965:Fras1 UTSW 5 96726580 missense possibly damaging 0.95
R4989:Fras1 UTSW 5 96650682 missense possibly damaging 0.75
R5151:Fras1 UTSW 5 96645110 missense probably damaging 1.00
R5168:Fras1 UTSW 5 96708757 missense probably benign 0.00
R5182:Fras1 UTSW 5 96636173 nonsense probably null
R5214:Fras1 UTSW 5 96769593 missense probably damaging 1.00
R5220:Fras1 UTSW 5 96768363 missense probably damaging 1.00
R5235:Fras1 UTSW 5 96600750 missense probably benign 0.02
R5242:Fras1 UTSW 5 96657250 missense probably benign 0.11
R5253:Fras1 UTSW 5 96741025 missense probably damaging 0.99
R5260:Fras1 UTSW 5 96735187 missense possibly damaging 0.79
R5301:Fras1 UTSW 5 96657266 missense possibly damaging 0.88
R5411:Fras1 UTSW 5 96645160 missense probably benign 0.00
R5467:Fras1 UTSW 5 96780053 missense probably benign 0.04
R5543:Fras1 UTSW 5 96528535 missense probably benign 0.01
R5555:Fras1 UTSW 5 96677377 missense probably benign 0.34
R5602:Fras1 UTSW 5 96737021 missense probably damaging 1.00
R5664:Fras1 UTSW 5 96728535 missense possibly damaging 0.91
R5695:Fras1 UTSW 5 96781344 missense probably damaging 1.00
R5717:Fras1 UTSW 5 96781737 missense possibly damaging 0.93
R5742:Fras1 UTSW 5 96768381 missense possibly damaging 0.50
R5759:Fras1 UTSW 5 96709916 missense probably benign 0.02
R5766:Fras1 UTSW 5 96731689 missense possibly damaging 0.91
R5890:Fras1 UTSW 5 96645948 missense probably benign
R6052:Fras1 UTSW 5 96764866 missense probably damaging 1.00
R6058:Fras1 UTSW 5 96709985 missense probably benign
R6256:Fras1 UTSW 5 96733843 missense possibly damaging 0.84
R6306:Fras1 UTSW 5 96764946 missense probably damaging 1.00
R6494:Fras1 UTSW 5 96759564 missense possibly damaging 0.59
R6638:Fras1 UTSW 5 96758094 missense possibly damaging 0.94
R6647:Fras1 UTSW 5 96735202 missense probably damaging 1.00
R6725:Fras1 UTSW 5 96781340 missense possibly damaging 0.91
R6769:Fras1 UTSW 5 96598941 missense possibly damaging 0.60
R6771:Fras1 UTSW 5 96598941 missense possibly damaging 0.60
R6837:Fras1 UTSW 5 96726973 missense probably damaging 0.99
R6841:Fras1 UTSW 5 96728551 missense probably damaging 0.99
R6863:Fras1 UTSW 5 96543306 missense probably benign 0.19
R6868:Fras1 UTSW 5 96682378 missense probably benign 0.38
R6936:Fras1 UTSW 5 96768352 missense possibly damaging 0.92
R6997:Fras1 UTSW 5 96614873 nonsense probably null
R7023:Fras1 UTSW 5 96710084 missense probably benign 0.00
R7091:Fras1 UTSW 5 96708676 missense not run
R7102:Fras1 UTSW 5 96571041 missense not run
R7120:Fras1 UTSW 5 96752960 nonsense probably null
R7124:Fras1 UTSW 5 96714401 missense not run
R7129:Fras1 UTSW 5 96781284 missense not run
Z1088:Fras1 UTSW 5 96743211 missense probably damaging 0.97
Z1088:Fras1 UTSW 5 96758142 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCTGAGACAAAGGAGGCTAGATGC -3'
(R):5'- GTCTACTAATGGCACCCACACTGC -3'

Sequencing Primer
(F):5'- gggaggcagagagaaatgag -3'
(R):5'- GCACCCACACTGCCTTTG -3'
Posted On2014-04-13