Incidental Mutation 'R1528:Tsen2'
ID166354
Institutional Source Beutler Lab
Gene Symbol Tsen2
Ensembl Gene ENSMUSG00000042389
Gene NametRNA splicing endonuclease subunit 2
Synonyms
MMRRC Submission 039568-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R1528 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115544664-115578628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115560028 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 248 (H248Q)
Ref Sequence ENSEMBL: ENSMUSP00000038211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040234]
Predicted Effect probably benign
Transcript: ENSMUST00000040234
AA Change: H248Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000038211
Gene: ENSMUSG00000042389
AA Change: H248Q

DomainStartEndE-ValueType
Blast:HOLI 1 55 2e-23 BLAST
Pfam:tRNA_int_endo_N 258 324 9.9e-16 PFAM
Pfam:tRNA_int_endo 334 426 5.2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123359
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the tRNA splicing endonuclease. This endonuclease catalyzes the first step in RNA splicing which is the removal of introns. Mutations in this gene have been associated with pontocerebellar hypoplasia type 2. A pseudogene has been identified on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,067,696 Q262L possibly damaging Het
4921501E09Rik A G 17: 33,067,241 S196P probably damaging Het
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Abcg4 T C 9: 44,274,723 Y617C probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ano1 T G 7: 144,595,566 S853R probably damaging Het
Ap4e1 T A 2: 127,011,823 S60R possibly damaging Het
Atp4b C A 8: 13,389,693 K176N possibly damaging Het
Atxn2 A T 5: 121,802,108 D982V probably damaging Het
Atxn2 T C 5: 121,813,530 F646S probably damaging Het
Bcl2l13 T C 6: 120,870,794 C136R possibly damaging Het
Cacna1i A G 15: 80,391,774 probably null Het
Ccdc122 T A 14: 77,067,939 V11D possibly damaging Het
Cdnf A G 2: 3,521,041 D90G probably damaging Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Chmp6 A G 11: 119,916,715 D128G probably benign Het
Clec18a A T 8: 111,078,866 M201K probably benign Het
Col11a1 A T 3: 114,216,995 probably benign Het
Col6a4 A T 9: 106,075,220 M493K probably damaging Het
Crygd A C 1: 65,063,057 probably null Het
Dennd1c T C 17: 57,066,935 T543A probably benign Het
Erbb4 A T 1: 68,078,582 C891* probably null Het
Ercc5 A T 1: 44,178,241 K915* probably null Het
Ercc6 A T 14: 32,519,022 N168Y probably damaging Het
Esrp2 G T 8: 106,136,752 P6T unknown Het
Exoc1 A G 5: 76,549,564 K396R possibly damaging Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Fgf7 T A 2: 126,035,818 M35K probably damaging Het
Fras1 G A 5: 96,636,819 G887D probably damaging Het
Fuk A T 8: 110,883,241 L1047Q probably damaging Het
Gbp4 A T 5: 105,121,792 probably null Het
Homez A T 14: 54,857,705 M182K probably benign Het
Hrnr G A 3: 93,322,794 S113N possibly damaging Het
Ifit3b T G 19: 34,611,672 S83A probably benign Het
Ildr2 A G 1: 166,270,495 probably null Het
Klhdc1 A T 12: 69,263,198 R291S probably benign Het
Krt77 T A 15: 101,861,088 I413F probably damaging Het
Lipn A G 19: 34,068,670 I14M probably damaging Het
Macf1 T G 4: 123,476,014 R86S probably benign Het
Mroh8 C A 2: 157,230,055 G510V probably damaging Het
Mycbp2 A T 14: 103,232,597 D1255E possibly damaging Het
Nckap5 C T 1: 126,024,922 V1234I possibly damaging Het
Nlrp9c T C 7: 26,382,298 K668E probably damaging Het
Nod2 T C 8: 88,664,589 M508T possibly damaging Het
Npffr1 A G 10: 61,614,237 M97V possibly damaging Het
Nsd3 G A 8: 25,698,767 V43M probably damaging Het
Nubp2 A G 17: 24,884,414 V163A probably damaging Het
Oas1e A T 5: 120,787,989 F338Y probably damaging Het
Oat C A 7: 132,564,269 G196C probably damaging Het
Olfr1241 C T 2: 89,482,553 G194D probably damaging Het
Olfr57 T C 10: 79,035,564 L256P probably damaging Het
Olfr675 A T 7: 105,024,764 L72Q probably damaging Het
P2ry13 T C 3: 59,210,289 T23A probably benign Het
Pja2 C A 17: 64,309,222 S226I possibly damaging Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Plekhs1 T C 19: 56,479,995 S332P probably damaging Het
Polr3e T A 7: 120,940,597 N522K probably damaging Het
Prdm10 A G 9: 31,357,286 T844A probably damaging Het
Ripk1 C T 13: 34,028,147 P480L probably benign Het
Rnf139 T C 15: 58,899,215 V363A probably damaging Het
Rnf19a A T 15: 36,265,655 S99T possibly damaging Het
Rnf224 G A 2: 25,236,098 T81I probably benign Het
Rpgrip1 T C 14: 52,112,224 L23S probably benign Het
Setd5 T A 6: 113,121,738 F758L probably damaging Het
Smlr1 C A 10: 25,536,078 V4L possibly damaging Het
Snx1 T C 9: 66,109,543 D34G probably damaging Het
Spaca5 A T X: 21,076,653 T92S probably benign Het
Speer4f2 A G 5: 17,376,542 T161A possibly damaging Het
Swi5 C A 2: 32,280,704 probably null Het
Syne2 T A 12: 75,966,100 D2689E probably benign Het
Tcof1 T A 18: 60,814,999 K1299* probably null Het
Tmprss11e G A 5: 86,724,210 T49I probably damaging Het
Tmx3 T A 18: 90,537,086 V309D possibly damaging Het
Trim30b C G 7: 104,357,299 V117L possibly damaging Het
Ttn T C 2: 76,737,068 Y19500C probably damaging Het
Tubgcp2 A G 7: 140,033,783 probably benign Het
Vwf A C 6: 125,608,291 D712A possibly damaging Het
Wfdc2 A G 2: 164,565,908 K166E probably damaging Het
Xrcc2 T C 5: 25,692,294 D219G probably benign Het
Zc3h6 C T 2: 129,017,069 P1007S probably benign Het
Zdhhc17 A T 10: 110,948,189 probably null Het
Zfp369 T A 13: 65,292,165 I221N probably damaging Het
Zfp655 A T 5: 145,244,601 N423I probably damaging Het
Other mutations in Tsen2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Tsen2 APN 6 115576984 missense probably damaging 1.00
IGL01409:Tsen2 APN 6 115559594 missense possibly damaging 0.72
IGL02002:Tsen2 APN 6 115559607 missense probably benign 0.12
IGL03301:Tsen2 APN 6 115568771 missense probably damaging 1.00
FR4304:Tsen2 UTSW 6 115560069 small insertion probably benign
FR4340:Tsen2 UTSW 6 115560066 small insertion probably benign
FR4340:Tsen2 UTSW 6 115560069 small insertion probably benign
FR4342:Tsen2 UTSW 6 115560072 small insertion probably benign
FR4548:Tsen2 UTSW 6 115560068 small insertion probably benign
FR4737:Tsen2 UTSW 6 115560077 small insertion probably benign
FR4976:Tsen2 UTSW 6 115560066 small insertion probably benign
R0141:Tsen2 UTSW 6 115568829 missense probably damaging 0.99
R1165:Tsen2 UTSW 6 115561435 missense probably damaging 1.00
R2152:Tsen2 UTSW 6 115547975 missense possibly damaging 0.94
R4022:Tsen2 UTSW 6 115547987 missense probably damaging 1.00
R4246:Tsen2 UTSW 6 115547824 splice site probably benign
R4247:Tsen2 UTSW 6 115547824 splice site probably benign
R4249:Tsen2 UTSW 6 115547824 splice site probably benign
R4774:Tsen2 UTSW 6 115575933 missense possibly damaging 0.92
R5511:Tsen2 UTSW 6 115561404 missense probably damaging 1.00
R5580:Tsen2 UTSW 6 115577980 missense probably damaging 1.00
R5935:Tsen2 UTSW 6 115559595 missense probably damaging 1.00
R6086:Tsen2 UTSW 6 115560075 missense probably benign 0.35
R6457:Tsen2 UTSW 6 115559631 missense probably benign 0.01
R6750:Tsen2 UTSW 6 115549920 missense probably damaging 1.00
R7009:Tsen2 UTSW 6 115547972 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGGAAAAGGATGAACTCCCCGTG -3'
(R):5'- ACAGCAATGCTCTCAGACTGTCG -3'

Sequencing Primer
(F):5'- GCTGGACAGTCAGATGACCTAC -3'
(R):5'- AGACTGTCGCTGACTGTAAC -3'
Posted On2014-04-13