Incidental Mutation 'R1528:Chmp6'
ID166387
Institutional Source Beutler Lab
Gene Symbol Chmp6
Ensembl Gene ENSMUSG00000025371
Gene Namecharged multivesicular body protein 6
Synonyms2400004G01Rik, chromatin modifying protein 6
MMRRC Submission 039568-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.886) question?
Stock #R1528 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119913441-119919548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119916715 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 128 (D128G)
Ref Sequence ENSEMBL: ENSMUSP00000026434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026434] [ENSMUST00000124199] [ENSMUST00000132197] [ENSMUST00000148232]
Predicted Effect probably benign
Transcript: ENSMUST00000026434
AA Change: D128G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000026434
Gene: ENSMUSG00000025371
AA Change: D128G

DomainStartEndE-ValueType
Pfam:Snf7 18 178 2.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124199
Predicted Effect probably benign
Transcript: ENSMUST00000132197
AA Change: D42G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114645
Gene: ENSMUSG00000025371
AA Change: D42G

DomainStartEndE-ValueType
Pfam:Snf7 1 78 5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139814
Predicted Effect probably benign
Transcript: ENSMUST00000148232
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chromatin-modifying protein/charged multivesicular body protein family. Proteins in this family are part of the ESCRT-III (endosomal sorting complex required for transport III) which degrades surface receptors, and in biosynthesis of endosomes. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,067,696 Q262L possibly damaging Het
4921501E09Rik A G 17: 33,067,241 S196P probably damaging Het
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Abcg4 T C 9: 44,274,723 Y617C probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ano1 T G 7: 144,595,566 S853R probably damaging Het
Ap4e1 T A 2: 127,011,823 S60R possibly damaging Het
Atp4b C A 8: 13,389,693 K176N possibly damaging Het
Atxn2 A T 5: 121,802,108 D982V probably damaging Het
Atxn2 T C 5: 121,813,530 F646S probably damaging Het
Bcl2l13 T C 6: 120,870,794 C136R possibly damaging Het
Cacna1i A G 15: 80,391,774 probably null Het
Ccdc122 T A 14: 77,067,939 V11D possibly damaging Het
Cdnf A G 2: 3,521,041 D90G probably damaging Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Clec18a A T 8: 111,078,866 M201K probably benign Het
Col11a1 A T 3: 114,216,995 probably benign Het
Col6a4 A T 9: 106,075,220 M493K probably damaging Het
Crygd A C 1: 65,063,057 probably null Het
Dennd1c T C 17: 57,066,935 T543A probably benign Het
Erbb4 A T 1: 68,078,582 C891* probably null Het
Ercc5 A T 1: 44,178,241 K915* probably null Het
Ercc6 A T 14: 32,519,022 N168Y probably damaging Het
Esrp2 G T 8: 106,136,752 P6T unknown Het
Exoc1 A G 5: 76,549,564 K396R possibly damaging Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Fgf7 T A 2: 126,035,818 M35K probably damaging Het
Fras1 G A 5: 96,636,819 G887D probably damaging Het
Fuk A T 8: 110,883,241 L1047Q probably damaging Het
Gbp4 A T 5: 105,121,792 probably null Het
Homez A T 14: 54,857,705 M182K probably benign Het
Hrnr G A 3: 93,322,794 S113N possibly damaging Het
Ifit3b T G 19: 34,611,672 S83A probably benign Het
Ildr2 A G 1: 166,270,495 probably null Het
Klhdc1 A T 12: 69,263,198 R291S probably benign Het
Krt77 T A 15: 101,861,088 I413F probably damaging Het
Lipn A G 19: 34,068,670 I14M probably damaging Het
Macf1 T G 4: 123,476,014 R86S probably benign Het
Mroh8 C A 2: 157,230,055 G510V probably damaging Het
Mycbp2 A T 14: 103,232,597 D1255E possibly damaging Het
Nckap5 C T 1: 126,024,922 V1234I possibly damaging Het
Nlrp9c T C 7: 26,382,298 K668E probably damaging Het
Nod2 T C 8: 88,664,589 M508T possibly damaging Het
Npffr1 A G 10: 61,614,237 M97V possibly damaging Het
Nsd3 G A 8: 25,698,767 V43M probably damaging Het
Nubp2 A G 17: 24,884,414 V163A probably damaging Het
Oas1e A T 5: 120,787,989 F338Y probably damaging Het
Oat C A 7: 132,564,269 G196C probably damaging Het
Olfr1241 C T 2: 89,482,553 G194D probably damaging Het
Olfr57 T C 10: 79,035,564 L256P probably damaging Het
Olfr675 A T 7: 105,024,764 L72Q probably damaging Het
P2ry13 T C 3: 59,210,289 T23A probably benign Het
Pja2 C A 17: 64,309,222 S226I possibly damaging Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Plekhs1 T C 19: 56,479,995 S332P probably damaging Het
Polr3e T A 7: 120,940,597 N522K probably damaging Het
Prdm10 A G 9: 31,357,286 T844A probably damaging Het
Ripk1 C T 13: 34,028,147 P480L probably benign Het
Rnf139 T C 15: 58,899,215 V363A probably damaging Het
Rnf19a A T 15: 36,265,655 S99T possibly damaging Het
Rnf224 G A 2: 25,236,098 T81I probably benign Het
Rpgrip1 T C 14: 52,112,224 L23S probably benign Het
Setd5 T A 6: 113,121,738 F758L probably damaging Het
Smlr1 C A 10: 25,536,078 V4L possibly damaging Het
Snx1 T C 9: 66,109,543 D34G probably damaging Het
Spaca5 A T X: 21,076,653 T92S probably benign Het
Speer4f2 A G 5: 17,376,542 T161A possibly damaging Het
Swi5 C A 2: 32,280,704 probably null Het
Syne2 T A 12: 75,966,100 D2689E probably benign Het
Tcof1 T A 18: 60,814,999 K1299* probably null Het
Tmprss11e G A 5: 86,724,210 T49I probably damaging Het
Tmx3 T A 18: 90,537,086 V309D possibly damaging Het
Trim30b C G 7: 104,357,299 V117L possibly damaging Het
Tsen2 C A 6: 115,560,028 H248Q probably benign Het
Ttn T C 2: 76,737,068 Y19500C probably damaging Het
Tubgcp2 A G 7: 140,033,783 probably benign Het
Vwf A C 6: 125,608,291 D712A possibly damaging Het
Wfdc2 A G 2: 164,565,908 K166E probably damaging Het
Xrcc2 T C 5: 25,692,294 D219G probably benign Het
Zc3h6 C T 2: 129,017,069 P1007S probably benign Het
Zdhhc17 A T 10: 110,948,189 probably null Het
Zfp369 T A 13: 65,292,165 I221N probably damaging Het
Zfp655 A T 5: 145,244,601 N423I probably damaging Het
Other mutations in Chmp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Chmp6 APN 11 119916986 missense probably benign 0.19
IGL03405:Chmp6 APN 11 119915447 missense probably damaging 1.00
R0035:Chmp6 UTSW 11 119916682 missense probably damaging 0.99
R0164:Chmp6 UTSW 11 119915523 critical splice donor site probably null
R0164:Chmp6 UTSW 11 119915523 critical splice donor site probably null
R0345:Chmp6 UTSW 11 119918046 unclassified probably benign
R2187:Chmp6 UTSW 11 119916736 missense possibly damaging 0.95
R5026:Chmp6 UTSW 11 119918643 missense probably damaging 0.98
R5799:Chmp6 UTSW 11 119916691 missense probably benign 0.41
R7059:Chmp6 UTSW 11 119916040 missense probably damaging 0.98
X0025:Chmp6 UTSW 11 119916116 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACACCACGCAGGAAGGATTTCCAG -3'
(R):5'- CGGCCAGCAGCTCATCAATTTG -3'

Sequencing Primer
(F):5'- CAGGAAGGATTTCCAGTTTTGACC -3'
(R):5'- AGCAGCTCATCAATTTGCTGTG -3'
Posted On2014-04-13