Incidental Mutation 'R1528:Rpgrip1'
ID166395
Institutional Source Beutler Lab
Gene Symbol Rpgrip1
Ensembl Gene ENSMUSG00000057132
Gene Nameretinitis pigmentosa GTPase regulator interacting protein 1
SynonymsA930002K18Rik, 4930505G06Rik, 4930401L23Rik, nmf247
MMRRC Submission 039568-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R1528 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location52110704-52163546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52112224 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 23 (L23S)
Ref Sequence ENSEMBL: ENSMUSP00000137751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111600] [ENSMUST00000111603] [ENSMUST00000180646] [ENSMUST00000181401]
Predicted Effect probably benign
Transcript: ENSMUST00000111600
AA Change: L23S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107227
Gene: ENSMUSG00000057132
AA Change: L23S

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 542 N/A INTRINSIC
C2 602 707 1.08e-2 SMART
coiled coil region 746 795 N/A INTRINSIC
Blast:C2 958 1086 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111603
AA Change: L23S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107230
Gene: ENSMUSG00000057132
AA Change: L23S

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 543 N/A INTRINSIC
Pfam:C2-C2_1 582 721 1.9e-49 PFAM
C2 764 869 7.3e-5 SMART
coiled coil region 910 999 N/A INTRINSIC
Blast:C2 1162 1290 2e-37 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180484
Predicted Effect probably benign
Transcript: ENSMUST00000180646
AA Change: L23S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137751
Gene: ENSMUSG00000057132
AA Change: L23S

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181401
AA Change: L23S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138027
Gene: ENSMUSG00000057132
AA Change: L23S

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 547 N/A INTRINSIC
Pfam:DUF3250 605 710 2.8e-46 PFAM
C2 753 858 1.08e-2 SMART
coiled coil region 899 988 N/A INTRINSIC
Blast:C2 1151 1279 1e-37 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181823
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a photoreceptor protein that interacts with retinitis pigmentosa GTPase regulator protein and is a key component of cone and rod photoreceptor cells. Mutations in this gene lead to autosomal recessive congenital blindness. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in photoreceptor cell dysmorphology. By 3 months of age mutant animals show near complete loss of photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,067,696 Q262L possibly damaging Het
4921501E09Rik A G 17: 33,067,241 S196P probably damaging Het
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Abcg4 T C 9: 44,274,723 Y617C probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ano1 T G 7: 144,595,566 S853R probably damaging Het
Ap4e1 T A 2: 127,011,823 S60R possibly damaging Het
Atp4b C A 8: 13,389,693 K176N possibly damaging Het
Atxn2 A T 5: 121,802,108 D982V probably damaging Het
Atxn2 T C 5: 121,813,530 F646S probably damaging Het
Bcl2l13 T C 6: 120,870,794 C136R possibly damaging Het
Cacna1i A G 15: 80,391,774 probably null Het
Ccdc122 T A 14: 77,067,939 V11D possibly damaging Het
Cdnf A G 2: 3,521,041 D90G probably damaging Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Chmp6 A G 11: 119,916,715 D128G probably benign Het
Clec18a A T 8: 111,078,866 M201K probably benign Het
Col11a1 A T 3: 114,216,995 probably benign Het
Col6a4 A T 9: 106,075,220 M493K probably damaging Het
Crygd A C 1: 65,063,057 probably null Het
Dennd1c T C 17: 57,066,935 T543A probably benign Het
Erbb4 A T 1: 68,078,582 C891* probably null Het
Ercc5 A T 1: 44,178,241 K915* probably null Het
Ercc6 A T 14: 32,519,022 N168Y probably damaging Het
Esrp2 G T 8: 106,136,752 P6T unknown Het
Exoc1 A G 5: 76,549,564 K396R possibly damaging Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Fgf7 T A 2: 126,035,818 M35K probably damaging Het
Fras1 G A 5: 96,636,819 G887D probably damaging Het
Fuk A T 8: 110,883,241 L1047Q probably damaging Het
Gbp4 A T 5: 105,121,792 probably null Het
Homez A T 14: 54,857,705 M182K probably benign Het
Hrnr G A 3: 93,322,794 S113N possibly damaging Het
Ifit3b T G 19: 34,611,672 S83A probably benign Het
Ildr2 A G 1: 166,270,495 probably null Het
Klhdc1 A T 12: 69,263,198 R291S probably benign Het
Krt77 T A 15: 101,861,088 I413F probably damaging Het
Lipn A G 19: 34,068,670 I14M probably damaging Het
Macf1 T G 4: 123,476,014 R86S probably benign Het
Mroh8 C A 2: 157,230,055 G510V probably damaging Het
Mycbp2 A T 14: 103,232,597 D1255E possibly damaging Het
Nckap5 C T 1: 126,024,922 V1234I possibly damaging Het
Nlrp9c T C 7: 26,382,298 K668E probably damaging Het
Nod2 T C 8: 88,664,589 M508T possibly damaging Het
Npffr1 A G 10: 61,614,237 M97V possibly damaging Het
Nsd3 G A 8: 25,698,767 V43M probably damaging Het
Nubp2 A G 17: 24,884,414 V163A probably damaging Het
Oas1e A T 5: 120,787,989 F338Y probably damaging Het
Oat C A 7: 132,564,269 G196C probably damaging Het
Olfr1241 C T 2: 89,482,553 G194D probably damaging Het
Olfr57 T C 10: 79,035,564 L256P probably damaging Het
Olfr675 A T 7: 105,024,764 L72Q probably damaging Het
P2ry13 T C 3: 59,210,289 T23A probably benign Het
Pja2 C A 17: 64,309,222 S226I possibly damaging Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Plekhs1 T C 19: 56,479,995 S332P probably damaging Het
Polr3e T A 7: 120,940,597 N522K probably damaging Het
Prdm10 A G 9: 31,357,286 T844A probably damaging Het
Ripk1 C T 13: 34,028,147 P480L probably benign Het
Rnf139 T C 15: 58,899,215 V363A probably damaging Het
Rnf19a A T 15: 36,265,655 S99T possibly damaging Het
Rnf224 G A 2: 25,236,098 T81I probably benign Het
Setd5 T A 6: 113,121,738 F758L probably damaging Het
Smlr1 C A 10: 25,536,078 V4L possibly damaging Het
Snx1 T C 9: 66,109,543 D34G probably damaging Het
Spaca5 A T X: 21,076,653 T92S probably benign Het
Speer4f2 A G 5: 17,376,542 T161A possibly damaging Het
Swi5 C A 2: 32,280,704 probably null Het
Syne2 T A 12: 75,966,100 D2689E probably benign Het
Tcof1 T A 18: 60,814,999 K1299* probably null Het
Tmprss11e G A 5: 86,724,210 T49I probably damaging Het
Tmx3 T A 18: 90,537,086 V309D possibly damaging Het
Trim30b C G 7: 104,357,299 V117L possibly damaging Het
Tsen2 C A 6: 115,560,028 H248Q probably benign Het
Ttn T C 2: 76,737,068 Y19500C probably damaging Het
Tubgcp2 A G 7: 140,033,783 probably benign Het
Vwf A C 6: 125,608,291 D712A possibly damaging Het
Wfdc2 A G 2: 164,565,908 K166E probably damaging Het
Xrcc2 T C 5: 25,692,294 D219G probably benign Het
Zc3h6 C T 2: 129,017,069 P1007S probably benign Het
Zdhhc17 A T 10: 110,948,189 probably null Het
Zfp369 T A 13: 65,292,165 I221N probably damaging Het
Zfp655 A T 5: 145,244,601 N423I probably damaging Het
Other mutations in Rpgrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Rpgrip1 APN 14 52150438 unclassified probably null
IGL01016:Rpgrip1 APN 14 52145836 missense probably damaging 1.00
IGL01019:Rpgrip1 APN 14 52131176 missense possibly damaging 0.70
IGL01382:Rpgrip1 APN 14 52145477 missense possibly damaging 0.93
IGL01433:Rpgrip1 APN 14 52126377 missense probably damaging 1.00
IGL01528:Rpgrip1 APN 14 52112177 nonsense probably null
IGL01548:Rpgrip1 APN 14 52126271 splice site probably benign
IGL01652:Rpgrip1 APN 14 52145492 unclassified probably benign
IGL02040:Rpgrip1 APN 14 52121019 missense possibly damaging 0.86
IGL02113:Rpgrip1 APN 14 52133844 missense possibly damaging 0.85
IGL02121:Rpgrip1 APN 14 52147374 missense possibly damaging 0.89
IGL02185:Rpgrip1 APN 14 52112228 missense possibly damaging 0.72
IGL02234:Rpgrip1 APN 14 52131309 splice site probably benign
IGL02322:Rpgrip1 APN 14 52150042 missense possibly damaging 0.89
IGL02379:Rpgrip1 APN 14 52138888 missense possibly damaging 0.53
IGL02524:Rpgrip1 APN 14 52121054 missense probably benign 0.01
IGL02836:Rpgrip1 APN 14 52145257 unclassified probably null
IGL03264:Rpgrip1 APN 14 52140652 missense possibly damaging 0.53
IGL03410:Rpgrip1 APN 14 52158366 unclassified probably benign
FR4976:Rpgrip1 UTSW 14 52149394 utr 3 prime probably benign
FR4976:Rpgrip1 UTSW 14 52149544 utr 3 prime probably benign
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0089:Rpgrip1 UTSW 14 52149384 utr 3 prime probably benign
R0498:Rpgrip1 UTSW 14 52131314 splice site probably benign
R0602:Rpgrip1 UTSW 14 52133856 missense possibly damaging 0.72
R0776:Rpgrip1 UTSW 14 52141169 missense possibly damaging 0.85
R1139:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
R1715:Rpgrip1 UTSW 14 52140691 missense possibly damaging 0.53
R1934:Rpgrip1 UTSW 14 52114644 missense possibly damaging 0.53
R2087:Rpgrip1 UTSW 14 52136622 intron probably null
R2114:Rpgrip1 UTSW 14 52149567 missense probably benign 0.27
R3406:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R3835:Rpgrip1 UTSW 14 52147253 missense probably damaging 1.00
R4084:Rpgrip1 UTSW 14 52149351 missense possibly damaging 0.72
R4124:Rpgrip1 UTSW 14 52152324 splice site probably null
R4381:Rpgrip1 UTSW 14 52150449 missense possibly damaging 0.54
R4407:Rpgrip1 UTSW 14 52147399 missense probably damaging 1.00
R4520:Rpgrip1 UTSW 14 52152289 missense probably benign 0.08
R4904:Rpgrip1 UTSW 14 52121087 missense possibly damaging 0.86
R4904:Rpgrip1 UTSW 14 52160129 missense probably damaging 0.97
R5284:Rpgrip1 UTSW 14 52149276 missense probably damaging 1.00
R5342:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R5377:Rpgrip1 UTSW 14 52160195 missense possibly damaging 0.96
R5499:Rpgrip1 UTSW 14 52140585 missense probably benign 0.00
R5729:Rpgrip1 UTSW 14 52160160 missense probably benign 0.28
R5834:Rpgrip1 UTSW 14 52158382 missense probably damaging 0.99
R6157:Rpgrip1 UTSW 14 52112174 missense probably benign 0.00
R6455:Rpgrip1 UTSW 14 52141189 missense probably damaging 0.97
R6796:Rpgrip1 UTSW 14 52150012 missense probably damaging 1.00
X0024:Rpgrip1 UTSW 14 52141208 missense possibly damaging 0.85
X0026:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGCAGAAGACAGTCCAGTCCACAG -3'
(R):5'- taagaAGGCTCagaggtggctcag -3'

Sequencing Primer
(F):5'- TGAGGTGATGCAGCATCTAC -3'
(R):5'- gttcagttcccagcaccc -3'
Posted On2014-04-13