Incidental Mutation 'R1528:Krt77'
ID166404
Institutional Source Beutler Lab
Gene Symbol Krt77
Ensembl Gene ENSMUSG00000067594
Gene Namekeratin 77
Synonyms4732484G22Rik
MMRRC Submission 039568-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1528 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101858731-101869705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101861088 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 413 (I413F)
Ref Sequence ENSEMBL: ENSMUSP00000085311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087996]
Predicted Effect probably damaging
Transcript: ENSMUST00000087996
AA Change: I413F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085311
Gene: ENSMUSG00000067594
AA Change: I413F

DomainStartEndE-ValueType
Pfam:Keratin_2_head 4 163 1.5e-46 PFAM
Filament 166 479 6.11e-149 SMART
low complexity region 485 497 N/A INTRINSIC
low complexity region 500 543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229995
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in the skin and eccrine sweat glands. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,067,696 Q262L possibly damaging Het
4921501E09Rik A G 17: 33,067,241 S196P probably damaging Het
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Abcg4 T C 9: 44,274,723 Y617C probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ano1 T G 7: 144,595,566 S853R probably damaging Het
Ap4e1 T A 2: 127,011,823 S60R possibly damaging Het
Atp4b C A 8: 13,389,693 K176N possibly damaging Het
Atxn2 A T 5: 121,802,108 D982V probably damaging Het
Atxn2 T C 5: 121,813,530 F646S probably damaging Het
Bcl2l13 T C 6: 120,870,794 C136R possibly damaging Het
Cacna1i A G 15: 80,391,774 probably null Het
Ccdc122 T A 14: 77,067,939 V11D possibly damaging Het
Cdnf A G 2: 3,521,041 D90G probably damaging Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Chmp6 A G 11: 119,916,715 D128G probably benign Het
Clec18a A T 8: 111,078,866 M201K probably benign Het
Col11a1 A T 3: 114,216,995 probably benign Het
Col6a4 A T 9: 106,075,220 M493K probably damaging Het
Crygd A C 1: 65,063,057 probably null Het
Dennd1c T C 17: 57,066,935 T543A probably benign Het
Erbb4 A T 1: 68,078,582 C891* probably null Het
Ercc5 A T 1: 44,178,241 K915* probably null Het
Ercc6 A T 14: 32,519,022 N168Y probably damaging Het
Esrp2 G T 8: 106,136,752 P6T unknown Het
Exoc1 A G 5: 76,549,564 K396R possibly damaging Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Fgf7 T A 2: 126,035,818 M35K probably damaging Het
Fras1 G A 5: 96,636,819 G887D probably damaging Het
Fuk A T 8: 110,883,241 L1047Q probably damaging Het
Gbp4 A T 5: 105,121,792 probably null Het
Homez A T 14: 54,857,705 M182K probably benign Het
Hrnr G A 3: 93,322,794 S113N possibly damaging Het
Ifit3b T G 19: 34,611,672 S83A probably benign Het
Ildr2 A G 1: 166,270,495 probably null Het
Klhdc1 A T 12: 69,263,198 R291S probably benign Het
Lipn A G 19: 34,068,670 I14M probably damaging Het
Macf1 T G 4: 123,476,014 R86S probably benign Het
Mroh8 C A 2: 157,230,055 G510V probably damaging Het
Mycbp2 A T 14: 103,232,597 D1255E possibly damaging Het
Nckap5 C T 1: 126,024,922 V1234I possibly damaging Het
Nlrp9c T C 7: 26,382,298 K668E probably damaging Het
Nod2 T C 8: 88,664,589 M508T possibly damaging Het
Npffr1 A G 10: 61,614,237 M97V possibly damaging Het
Nsd3 G A 8: 25,698,767 V43M probably damaging Het
Nubp2 A G 17: 24,884,414 V163A probably damaging Het
Oas1e A T 5: 120,787,989 F338Y probably damaging Het
Oat C A 7: 132,564,269 G196C probably damaging Het
Olfr1241 C T 2: 89,482,553 G194D probably damaging Het
Olfr57 T C 10: 79,035,564 L256P probably damaging Het
Olfr675 A T 7: 105,024,764 L72Q probably damaging Het
P2ry13 T C 3: 59,210,289 T23A probably benign Het
Pja2 C A 17: 64,309,222 S226I possibly damaging Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Plekhs1 T C 19: 56,479,995 S332P probably damaging Het
Polr3e T A 7: 120,940,597 N522K probably damaging Het
Prdm10 A G 9: 31,357,286 T844A probably damaging Het
Ripk1 C T 13: 34,028,147 P480L probably benign Het
Rnf139 T C 15: 58,899,215 V363A probably damaging Het
Rnf19a A T 15: 36,265,655 S99T possibly damaging Het
Rnf224 G A 2: 25,236,098 T81I probably benign Het
Rpgrip1 T C 14: 52,112,224 L23S probably benign Het
Setd5 T A 6: 113,121,738 F758L probably damaging Het
Smlr1 C A 10: 25,536,078 V4L possibly damaging Het
Snx1 T C 9: 66,109,543 D34G probably damaging Het
Spaca5 A T X: 21,076,653 T92S probably benign Het
Speer4f2 A G 5: 17,376,542 T161A possibly damaging Het
Swi5 C A 2: 32,280,704 probably null Het
Syne2 T A 12: 75,966,100 D2689E probably benign Het
Tcof1 T A 18: 60,814,999 K1299* probably null Het
Tmprss11e G A 5: 86,724,210 T49I probably damaging Het
Tmx3 T A 18: 90,537,086 V309D possibly damaging Het
Trim30b C G 7: 104,357,299 V117L possibly damaging Het
Tsen2 C A 6: 115,560,028 H248Q probably benign Het
Ttn T C 2: 76,737,068 Y19500C probably damaging Het
Tubgcp2 A G 7: 140,033,783 probably benign Het
Vwf A C 6: 125,608,291 D712A possibly damaging Het
Wfdc2 A G 2: 164,565,908 K166E probably damaging Het
Xrcc2 T C 5: 25,692,294 D219G probably benign Het
Zc3h6 C T 2: 129,017,069 P1007S probably benign Het
Zdhhc17 A T 10: 110,948,189 probably null Het
Zfp369 T A 13: 65,292,165 I221N probably damaging Het
Zfp655 A T 5: 145,244,601 N423I probably damaging Het
Other mutations in Krt77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Krt77 APN 15 101860880 splice site probably benign
IGL01912:Krt77 APN 15 101863851 splice site probably benign
IGL02505:Krt77 APN 15 101860946 missense probably damaging 1.00
IGL02875:Krt77 APN 15 101869149 missense probably damaging 1.00
R0266:Krt77 UTSW 15 101869378 missense possibly damaging 0.71
R0347:Krt77 UTSW 15 101859869 missense unknown
R0762:Krt77 UTSW 15 101861126 intron probably null
R1556:Krt77 UTSW 15 101861278 missense probably damaging 0.96
R1973:Krt77 UTSW 15 101861244 missense probably damaging 1.00
R4434:Krt77 UTSW 15 101865469 missense probably damaging 1.00
R4436:Krt77 UTSW 15 101865469 missense probably damaging 1.00
R4946:Krt77 UTSW 15 101869563 missense unknown
R5405:Krt77 UTSW 15 101861088 missense probably damaging 0.96
R5507:Krt77 UTSW 15 101861230 missense probably benign 0.03
R5888:Krt77 UTSW 15 101865453 missense probably benign 0.29
R5978:Krt77 UTSW 15 101862928 missense probably benign 0.07
R5994:Krt77 UTSW 15 101862855 missense probably damaging 1.00
R6039:Krt77 UTSW 15 101860916 missense possibly damaging 0.85
R6039:Krt77 UTSW 15 101860916 missense possibly damaging 0.85
R6241:Krt77 UTSW 15 101865553 missense probably damaging 1.00
R6260:Krt77 UTSW 15 101864372 nonsense probably null
R6280:Krt77 UTSW 15 101865475 missense probably damaging 1.00
R6500:Krt77 UTSW 15 101864337 missense probably damaging 0.99
R6563:Krt77 UTSW 15 101862923 missense probably damaging 1.00
R7153:Krt77 UTSW 15 101865496 missense not run
Predicted Primers PCR Primer
(F):5'- GCTAGGGTAGAAGCACCATGCTTG -3'
(R):5'- CTCAACCGTAACATCCAGAGGCTG -3'

Sequencing Primer
(F):5'- AACCTGGCTGCTGTACAC -3'
(R):5'- GGCAGAGATCGCCAATATCAAG -3'
Posted On2014-04-13