Incidental Mutation 'R1528:Nubp2'
ID166406
Institutional Source Beutler Lab
Gene Symbol Nubp2
Ensembl Gene ENSMUSG00000039183
Gene Namenucleotide binding protein 2
SynonymsD17Wsu11e
MMRRC Submission 039568-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R1528 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24882611-24886350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24884414 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 163 (V163A)
Ref Sequence ENSEMBL: ENSMUSP00000049319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024976] [ENSMUST00000044252] [ENSMUST00000050714] [ENSMUST00000068508] [ENSMUST00000117890] [ENSMUST00000119829] [ENSMUST00000119848] [ENSMUST00000120943] [ENSMUST00000130194] [ENSMUST00000144430] [ENSMUST00000168265]
Predicted Effect probably benign
Transcript: ENSMUST00000024976
SMART Domains Protein: ENSMUSP00000024976
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Pfam:SPRY 181 304 5.7e-18 PFAM
SOCS_box 309 347 2.8e0 SMART
low complexity region 364 373 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000044252
AA Change: V163A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049319
Gene: ENSMUSG00000039183
AA Change: V163A

DomainStartEndE-ValueType
Pfam:ParA 16 267 3.2e-99 PFAM
Pfam:ArsA_ATPase 19 66 1.7e-8 PFAM
Pfam:AAA_31 19 79 1.5e-8 PFAM
Pfam:MipZ 19 155 2.1e-10 PFAM
Pfam:CbiA 21 199 2.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050714
SMART Domains Protein: ENSMUSP00000060169
Gene: ENSMUSG00000046070

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 40 78 9.37e-10 SMART
LRR 77 96 1.62e1 SMART
LRR 97 120 1.41e1 SMART
LRR_TYP 121 144 6.78e-3 SMART
LRR 145 168 1.03e1 SMART
LRR_TYP 169 192 1.1e-2 SMART
LRR 193 216 2.17e-1 SMART
LRR_TYP 217 240 2.4e-3 SMART
LRR_TYP 241 264 1.82e-3 SMART
LRR 265 288 5.72e-1 SMART
LRR_TYP 289 312 6.23e-2 SMART
LRR_TYP 313 336 6.32e-3 SMART
LRR_TYP 337 360 2.2e-2 SMART
LRR 361 384 1.89e-1 SMART
LRR 385 408 3.87e1 SMART
LRR 409 432 2.67e-1 SMART
LRR_TYP 433 456 1.06e-4 SMART
LRR_TYP 457 480 6.78e-3 SMART
LRR 481 504 1.09e2 SMART
LRR 505 530 2.68e1 SMART
LRRCT 535 582 5.11e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068508
SMART Domains Protein: ENSMUSP00000068567
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 252 1.3e-13 PFAM
low complexity region 295 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117890
SMART Domains Protein: ENSMUSP00000112380
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119829
SMART Domains Protein: ENSMUSP00000112589
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 294 6.9e-16 PFAM
SOCS_box 299 337 2.8e0 SMART
low complexity region 354 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119848
SMART Domains Protein: ENSMUSP00000113167
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 8.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120943
SMART Domains Protein: ENSMUSP00000112492
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130194
SMART Domains Protein: ENSMUSP00000119896
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134932
Predicted Effect probably benign
Transcript: ENSMUST00000144430
SMART Domains Protein: ENSMUSP00000117226
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168265
SMART Domains Protein: ENSMUSP00000126878
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
Pfam:SPRY 294 416 5.8e-20 PFAM
SOCS_box 420 458 2.8e0 SMART
low complexity region 475 484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adenosine triphosphate (ATP) and metal-binding protein that is required for the assembly of cyotosolic iron-sulfur proteins. The encoded protein functions in a heterotetramer with nucleotide-binding protein 1 (NUBP1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,067,696 Q262L possibly damaging Het
4921501E09Rik A G 17: 33,067,241 S196P probably damaging Het
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Abcg4 T C 9: 44,274,723 Y617C probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ano1 T G 7: 144,595,566 S853R probably damaging Het
Ap4e1 T A 2: 127,011,823 S60R possibly damaging Het
Atp4b C A 8: 13,389,693 K176N possibly damaging Het
Atxn2 A T 5: 121,802,108 D982V probably damaging Het
Atxn2 T C 5: 121,813,530 F646S probably damaging Het
Bcl2l13 T C 6: 120,870,794 C136R possibly damaging Het
Cacna1i A G 15: 80,391,774 probably null Het
Ccdc122 T A 14: 77,067,939 V11D possibly damaging Het
Cdnf A G 2: 3,521,041 D90G probably damaging Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Chmp6 A G 11: 119,916,715 D128G probably benign Het
Clec18a A T 8: 111,078,866 M201K probably benign Het
Col11a1 A T 3: 114,216,995 probably benign Het
Col6a4 A T 9: 106,075,220 M493K probably damaging Het
Crygd A C 1: 65,063,057 probably null Het
Dennd1c T C 17: 57,066,935 T543A probably benign Het
Erbb4 A T 1: 68,078,582 C891* probably null Het
Ercc5 A T 1: 44,178,241 K915* probably null Het
Ercc6 A T 14: 32,519,022 N168Y probably damaging Het
Esrp2 G T 8: 106,136,752 P6T unknown Het
Exoc1 A G 5: 76,549,564 K396R possibly damaging Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Fgf7 T A 2: 126,035,818 M35K probably damaging Het
Fras1 G A 5: 96,636,819 G887D probably damaging Het
Fuk A T 8: 110,883,241 L1047Q probably damaging Het
Gbp4 A T 5: 105,121,792 probably null Het
Homez A T 14: 54,857,705 M182K probably benign Het
Hrnr G A 3: 93,322,794 S113N possibly damaging Het
Ifit3b T G 19: 34,611,672 S83A probably benign Het
Ildr2 A G 1: 166,270,495 probably null Het
Klhdc1 A T 12: 69,263,198 R291S probably benign Het
Krt77 T A 15: 101,861,088 I413F probably damaging Het
Lipn A G 19: 34,068,670 I14M probably damaging Het
Macf1 T G 4: 123,476,014 R86S probably benign Het
Mroh8 C A 2: 157,230,055 G510V probably damaging Het
Mycbp2 A T 14: 103,232,597 D1255E possibly damaging Het
Nckap5 C T 1: 126,024,922 V1234I possibly damaging Het
Nlrp9c T C 7: 26,382,298 K668E probably damaging Het
Nod2 T C 8: 88,664,589 M508T possibly damaging Het
Npffr1 A G 10: 61,614,237 M97V possibly damaging Het
Nsd3 G A 8: 25,698,767 V43M probably damaging Het
Oas1e A T 5: 120,787,989 F338Y probably damaging Het
Oat C A 7: 132,564,269 G196C probably damaging Het
Olfr1241 C T 2: 89,482,553 G194D probably damaging Het
Olfr57 T C 10: 79,035,564 L256P probably damaging Het
Olfr675 A T 7: 105,024,764 L72Q probably damaging Het
P2ry13 T C 3: 59,210,289 T23A probably benign Het
Pja2 C A 17: 64,309,222 S226I possibly damaging Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Plekhs1 T C 19: 56,479,995 S332P probably damaging Het
Polr3e T A 7: 120,940,597 N522K probably damaging Het
Prdm10 A G 9: 31,357,286 T844A probably damaging Het
Ripk1 C T 13: 34,028,147 P480L probably benign Het
Rnf139 T C 15: 58,899,215 V363A probably damaging Het
Rnf19a A T 15: 36,265,655 S99T possibly damaging Het
Rnf224 G A 2: 25,236,098 T81I probably benign Het
Rpgrip1 T C 14: 52,112,224 L23S probably benign Het
Setd5 T A 6: 113,121,738 F758L probably damaging Het
Smlr1 C A 10: 25,536,078 V4L possibly damaging Het
Snx1 T C 9: 66,109,543 D34G probably damaging Het
Spaca5 A T X: 21,076,653 T92S probably benign Het
Speer4f2 A G 5: 17,376,542 T161A possibly damaging Het
Swi5 C A 2: 32,280,704 probably null Het
Syne2 T A 12: 75,966,100 D2689E probably benign Het
Tcof1 T A 18: 60,814,999 K1299* probably null Het
Tmprss11e G A 5: 86,724,210 T49I probably damaging Het
Tmx3 T A 18: 90,537,086 V309D possibly damaging Het
Trim30b C G 7: 104,357,299 V117L possibly damaging Het
Tsen2 C A 6: 115,560,028 H248Q probably benign Het
Ttn T C 2: 76,737,068 Y19500C probably damaging Het
Tubgcp2 A G 7: 140,033,783 probably benign Het
Vwf A C 6: 125,608,291 D712A possibly damaging Het
Wfdc2 A G 2: 164,565,908 K166E probably damaging Het
Xrcc2 T C 5: 25,692,294 D219G probably benign Het
Zc3h6 C T 2: 129,017,069 P1007S probably benign Het
Zdhhc17 A T 10: 110,948,189 probably null Het
Zfp369 T A 13: 65,292,165 I221N probably damaging Het
Zfp655 A T 5: 145,244,601 N423I probably damaging Het
Other mutations in Nubp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02706:Nubp2 APN 17 24883197 missense probably benign 0.06
R0238:Nubp2 UTSW 17 24884471 missense probably damaging 1.00
R0238:Nubp2 UTSW 17 24884471 missense probably damaging 1.00
R0239:Nubp2 UTSW 17 24884471 missense probably damaging 1.00
R0239:Nubp2 UTSW 17 24884471 missense probably damaging 1.00
R1329:Nubp2 UTSW 17 24883864 missense possibly damaging 0.91
R4270:Nubp2 UTSW 17 24885593 missense probably damaging 1.00
R4860:Nubp2 UTSW 17 24884456 missense probably benign
R4860:Nubp2 UTSW 17 24884456 missense probably benign
R5799:Nubp2 UTSW 17 24885798 missense probably damaging 0.96
R6495:Nubp2 UTSW 17 24885603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGACACCGCCTGTGGATCAGAG -3'
(R):5'- AGCTGCCCAGAAGCAACTGATG -3'

Sequencing Primer
(F):5'- TCAGAGGAGGGGCCAGTC -3'
(R):5'- CTGGACAAGATGGGCCTTTC -3'
Posted On2014-04-13