Incidental Mutation 'R1529:Atp2b4'
ID166422
Institutional Source Beutler Lab
Gene Symbol Atp2b4
Ensembl Gene ENSMUSG00000026463
Gene NameATPase, Ca++ transporting, plasma membrane 4
SynonymsPMCA4
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R1529 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location133699457-133801041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133717988 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 943 (F943L)
Ref Sequence ENSEMBL: ENSMUSP00000133187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048953] [ENSMUST00000112264] [ENSMUST00000125659] [ENSMUST00000143567] [ENSMUST00000165602]
Predicted Effect probably damaging
Transcript: ENSMUST00000048953
AA Change: F943L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047978
Gene: ENSMUSG00000026463
AA Change: F943L

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.7e-58 PFAM
Pfam:Hydrolase 460 798 3e-26 PFAM
Pfam:HAD 463 795 7.4e-15 PFAM
Pfam:Hydrolase_like2 510 605 3.6e-17 PFAM
Pfam:Hydrolase_3 756 831 2.7e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1153 1.8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112264
AA Change: F943L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107883
Gene: ENSMUSG00000026463
AA Change: F943L

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.3e-58 PFAM
Pfam:Hydrolase 460 798 1.2e-26 PFAM
Pfam:HAD 463 795 3.5e-15 PFAM
Pfam:Hydrolase_like2 510 605 4.6e-17 PFAM
Pfam:Hydrolase_3 756 831 9.1e-7 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1104 7.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125659
AA Change: F943L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116941
Gene: ENSMUSG00000026463
AA Change: F943L

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.7e-58 PFAM
Pfam:Hydrolase 460 798 3e-26 PFAM
Pfam:HAD 463 795 7.4e-15 PFAM
Pfam:Hydrolase_like2 510 605 3.6e-17 PFAM
Pfam:Hydrolase_3 756 831 2.7e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1153 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140810
Predicted Effect probably damaging
Transcript: ENSMUST00000143567
AA Change: F943L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119242
Gene: ENSMUSG00000026463
AA Change: F943L

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 153 301 6.8e-29 PFAM
Pfam:E1-E2_ATPase 338 455 1.9e-13 PFAM
Pfam:HAD 463 795 1e-21 PFAM
Pfam:Cation_ATPase 509 605 5.8e-17 PFAM
Pfam:Hydrolase 577 798 5e-15 PFAM
Pfam:Hydrolase_3 756 831 6.6e-7 PFAM
Pfam:Cation_ATPase_C 868 1050 4.5e-45 PFAM
Pfam:ATP_Ca_trans_C 1090 1141 3.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165602
AA Change: F943L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133187
Gene: ENSMUSG00000026463
AA Change: F943L

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.5e-58 PFAM
Pfam:Hydrolase 460 798 1.4e-26 PFAM
Pfam:HAD 463 795 4.1e-15 PFAM
Pfam:Hydrolase_like2 510 605 5.1e-17 PFAM
Pfam:Hydrolase_3 756 831 1e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.3e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1151 4.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 4. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility with impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik G A 17: 47,413,890 S102L probably benign Het
A430105I19Rik T A 2: 118,761,760 probably null Het
Adam11 T C 11: 102,775,113 probably null Het
AI314180 T C 4: 58,832,701 probably null Het
Amd1 A T 10: 40,290,505 M194K probably benign Het
Ap1b1 T G 11: 5,039,547 F793C probably damaging Het
Arfgef3 G A 10: 18,613,222 R1292* probably null Het
Arhgef5 C A 6: 43,279,515 H1186N probably damaging Het
Atad1 A G 19: 32,706,921 F26L probably benign Het
Atg2b C T 12: 105,661,133 V532I probably benign Het
Atp7b G A 8: 22,028,724 L21F possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Ckmt2 A T 13: 91,861,201 D202E probably benign Het
Crim1 A C 17: 78,367,954 K864T probably benign Het
Ctnnd2 A G 15: 30,887,121 R765G possibly damaging Het
Ddx10 T A 9: 53,117,199 R802* probably null Het
Dnah7b T A 1: 46,177,281 F1152L probably damaging Het
Dsg1c T C 18: 20,282,023 L659P probably damaging Het
Dzank1 A G 2: 144,482,188 F577L probably benign Het
Eci3 T C 13: 34,956,920 D93G probably benign Het
Ep400 C A 5: 110,739,445 V591L probably benign Het
Fam126b A T 1: 58,539,607 D261E probably benign Het
Fgd3 T C 13: 49,266,694 N569S probably benign Het
Ghsr T A 3: 27,372,482 V229E probably damaging Het
Gm8298 T C 3: 59,861,112 I21T probably benign Het
Gna15 T A 10: 81,509,342 I230F probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Grid1 T C 14: 35,309,293 V281A probably benign Het
Hebp2 G A 10: 18,545,761 A12V possibly damaging Het
Hfm1 T C 5: 106,853,123 D1254G probably benign Het
Hif3a A C 7: 17,042,639 S459A probably benign Het
Hnrnpl T A 7: 28,813,923 N149K possibly damaging Het
Hoxc10 A T 15: 102,967,200 S115C probably damaging Het
Ifnab T C 4: 88,691,055 D58G possibly damaging Het
Itfg1 T C 8: 85,810,614 T195A probably benign Het
Itpr3 T A 17: 27,105,485 probably null Het
Iws1 A G 18: 32,080,281 D254G probably benign Het
Kl C A 5: 150,988,941 D718E probably benign Het
Lrit2 A G 14: 37,068,827 I154M probably benign Het
Lrp2 T C 2: 69,523,182 D578G probably damaging Het
Lss T G 10: 76,536,289 Y159* probably null Het
Mab21l1 C A 3: 55,783,833 Y280* probably null Het
Maf A T 8: 115,693,170 S378T probably benign Het
Mast2 C T 4: 116,430,519 V59I probably benign Het
Nisch C T 14: 31,180,938 probably benign Het
Nova2 A T 7: 18,957,554 N139Y probably damaging Het
Nup210 C A 6: 91,036,376 D434Y probably damaging Het
Nvl C T 1: 181,109,159 probably null Het
Olfr1049 A T 2: 86,255,241 Y151N probably damaging Het
Olfr1087 A G 2: 86,690,333 V214A possibly damaging Het
Olfr577 A G 7: 102,973,879 Y38H probably damaging Het
Olfr657 A G 7: 104,636,489 T272A probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pbx3 T C 2: 34,204,859 Y255C probably damaging Het
Pcyt1a G A 16: 32,451,793 E27K possibly damaging Het
Pex6 A T 17: 46,714,064 T348S probably benign Het
Phf21b A G 15: 84,797,396 I251T probably damaging Het
Pkd2l2 T C 18: 34,430,702 I490T probably damaging Het
Pla2g12a T A 3: 129,878,885 L56Q probably damaging Het
Plk4 A G 3: 40,806,536 T434A probably benign Het
Ptpn13 A G 5: 103,564,132 N1632S probably benign Het
Rfpl4 C T 7: 5,110,712 V151M probably damaging Het
Rpain G C 11: 70,974,915 E169Q probably damaging Het
Samd8 T A 14: 21,775,159 V124D possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc12a1 C T 2: 125,190,295 T622I probably damaging Het
Slc17a3 T A 13: 23,845,445 V67D probably damaging Het
Slc41a3 G T 6: 90,644,216 V387L probably damaging Het
Slitrk1 T A 14: 108,913,277 M1L probably benign Het
Stat4 T C 1: 52,011,793 W4R probably damaging Het
Tas2r126 A G 6: 42,434,568 T12A probably benign Het
Tbc1d24 A G 17: 24,185,979 C64R probably damaging Het
Tcaf2 T C 6: 42,629,506 S505G probably benign Het
Tiam2 T C 17: 3,516,703 V1506A probably benign Het
Tmem9b A C 7: 109,736,949 S163A probably benign Het
Tmtc2 G A 10: 105,303,658 S669L probably damaging Het
Tnpo3 A T 6: 29,560,221 I641K possibly damaging Het
Ttn C T 2: 76,735,367 A28214T probably damaging Het
Utp11 G A 4: 124,683,239 A113V probably benign Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Vmn1r60 A T 7: 5,544,903 I66N probably benign Het
Zeb2 T C 2: 44,997,194 E572G probably damaging Het
Other mutations in Atp2b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Atp2b4 APN 1 133731889 missense probably damaging 1.00
IGL02887:Atp2b4 APN 1 133728774 missense probably damaging 1.00
IGL02964:Atp2b4 APN 1 133730565 missense probably damaging 1.00
IGL03116:Atp2b4 APN 1 133728768 missense possibly damaging 0.95
IGL03227:Atp2b4 APN 1 133729707 splice site probably benign
R0018:Atp2b4 UTSW 1 133717871 missense probably damaging 1.00
R0018:Atp2b4 UTSW 1 133717871 missense probably damaging 1.00
R0279:Atp2b4 UTSW 1 133729702 splice site probably benign
R0455:Atp2b4 UTSW 1 133728716 missense probably damaging 1.00
R0511:Atp2b4 UTSW 1 133732218 splice site probably benign
R0712:Atp2b4 UTSW 1 133730478 missense probably damaging 1.00
R1469:Atp2b4 UTSW 1 133706939 missense probably damaging 0.97
R1469:Atp2b4 UTSW 1 133706939 missense probably damaging 0.97
R1771:Atp2b4 UTSW 1 133732393 missense probably damaging 0.96
R1954:Atp2b4 UTSW 1 133739992 missense probably damaging 1.00
R2054:Atp2b4 UTSW 1 133715169 missense probably benign 0.03
R2056:Atp2b4 UTSW 1 133726537 missense probably benign 0.36
R2059:Atp2b4 UTSW 1 133726537 missense probably benign 0.36
R2091:Atp2b4 UTSW 1 133715230 missense probably benign 0.00
R2263:Atp2b4 UTSW 1 133726533 missense probably benign 0.35
R3907:Atp2b4 UTSW 1 133738586 missense probably damaging 1.00
R4362:Atp2b4 UTSW 1 133739931 missense possibly damaging 0.94
R4756:Atp2b4 UTSW 1 133711791 missense probably benign 0.00
R4756:Atp2b4 UTSW 1 133739396 missense probably benign 0.41
R4856:Atp2b4 UTSW 1 133706780 missense probably benign 0.00
R4886:Atp2b4 UTSW 1 133706780 missense probably benign 0.00
R5177:Atp2b4 UTSW 1 133728768 missense probably benign 0.00
R5454:Atp2b4 UTSW 1 133729872 missense probably damaging 1.00
R5594:Atp2b4 UTSW 1 133730510 missense probably damaging 1.00
R5712:Atp2b4 UTSW 1 133730540 missense probably damaging 1.00
R6034:Atp2b4 UTSW 1 133731907 critical splice acceptor site probably null
R6034:Atp2b4 UTSW 1 133731907 critical splice acceptor site probably null
R6078:Atp2b4 UTSW 1 133701702 small insertion probably benign
R6079:Atp2b4 UTSW 1 133701702 small insertion probably benign
R6244:Atp2b4 UTSW 1 133726561 missense probably damaging 1.00
R6376:Atp2b4 UTSW 1 133715059 missense probably damaging 1.00
R6483:Atp2b4 UTSW 1 133729880 missense possibly damaging 0.68
R6526:Atp2b4 UTSW 1 133711729 missense probably damaging 0.99
R6725:Atp2b4 UTSW 1 133706987 missense probably benign 0.01
R6801:Atp2b4 UTSW 1 133727786 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GACGCCTGCAAACACGTTCTTC -3'
(R):5'- AACAAACGGGACTGATGCCAGC -3'

Sequencing Primer
(F):5'- CTCACCGTGGATCTTCCGAG -3'
(R):5'- gcaggcaaaacactcatacac -3'
Posted On2014-04-13