Incidental Mutation 'R1529:Slc12a1'
ID166433
Institutional Source Beutler Lab
Gene Symbol Slc12a1
Ensembl Gene ENSMUSG00000027202
Gene Namesolute carrier family 12, member 1
Synonymsurehr3, mBSC1, Nkcc2, D630042G03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R1529 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location125152505-125230002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125190295 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 622 (T622I)
Ref Sequence ENSEMBL: ENSMUSP00000028630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028630] [ENSMUST00000110494] [ENSMUST00000110495]
Predicted Effect probably damaging
Transcript: ENSMUST00000028630
AA Change: T622I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028630
Gene: ENSMUSG00000027202
AA Change: T622I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 82 152 5.3e-22 PFAM
Pfam:AA_permease 173 677 2.3e-152 PFAM
Pfam:AA_permease_2 177 636 2.6e-24 PFAM
coiled coil region 815 843 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110494
AA Change: T622I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106120
Gene: ENSMUSG00000027202
AA Change: T622I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 2.2e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110495
AA Change: T622I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106121
Gene: ENSMUSG00000027202
AA Change: T622I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 1.6e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kidney-specific sodium-potassium-chloride cotransporter that is expressed on the luminal membrane of renal epithelial cells of the thick ascending limb of Henle's loop and the macula densa. It plays a key role in concentrating urine and accounts for most of the NaCl resorption. It is sensitive to such diuretics as furosemide and bumetanide. Some Bartter-like syndromes result from defects in this gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity in humans has not been experimentally proven.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene do not survive to weaning and suffer from various metabolic abnormalities related to kidney function. Mice homozygous for an ENU-induced allele exhibit kidney disease, impaired urinary excretion of metabolism products, polyuria, and kidney alterations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik G A 17: 47,413,890 S102L probably benign Het
A430105I19Rik T A 2: 118,761,760 probably null Het
Adam11 T C 11: 102,775,113 probably null Het
AI314180 T C 4: 58,832,701 probably null Het
Amd1 A T 10: 40,290,505 M194K probably benign Het
Ap1b1 T G 11: 5,039,547 F793C probably damaging Het
Arfgef3 G A 10: 18,613,222 R1292* probably null Het
Arhgef5 C A 6: 43,279,515 H1186N probably damaging Het
Atad1 A G 19: 32,706,921 F26L probably benign Het
Atg2b C T 12: 105,661,133 V532I probably benign Het
Atp2b4 A G 1: 133,717,988 F943L probably damaging Het
Atp7b G A 8: 22,028,724 L21F possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Ckmt2 A T 13: 91,861,201 D202E probably benign Het
Crim1 A C 17: 78,367,954 K864T probably benign Het
Ctnnd2 A G 15: 30,887,121 R765G possibly damaging Het
Ddx10 T A 9: 53,117,199 R802* probably null Het
Dnah7b T A 1: 46,177,281 F1152L probably damaging Het
Dsg1c T C 18: 20,282,023 L659P probably damaging Het
Dzank1 A G 2: 144,482,188 F577L probably benign Het
Eci3 T C 13: 34,956,920 D93G probably benign Het
Ep400 C A 5: 110,739,445 V591L probably benign Het
Fam126b A T 1: 58,539,607 D261E probably benign Het
Fgd3 T C 13: 49,266,694 N569S probably benign Het
Ghsr T A 3: 27,372,482 V229E probably damaging Het
Gm8298 T C 3: 59,861,112 I21T probably benign Het
Gna15 T A 10: 81,509,342 I230F probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Grid1 T C 14: 35,309,293 V281A probably benign Het
Hebp2 G A 10: 18,545,761 A12V possibly damaging Het
Hfm1 T C 5: 106,853,123 D1254G probably benign Het
Hif3a A C 7: 17,042,639 S459A probably benign Het
Hnrnpl T A 7: 28,813,923 N149K possibly damaging Het
Hoxc10 A T 15: 102,967,200 S115C probably damaging Het
Ifnab T C 4: 88,691,055 D58G possibly damaging Het
Itfg1 T C 8: 85,810,614 T195A probably benign Het
Itpr3 T A 17: 27,105,485 probably null Het
Iws1 A G 18: 32,080,281 D254G probably benign Het
Kl C A 5: 150,988,941 D718E probably benign Het
Lrit2 A G 14: 37,068,827 I154M probably benign Het
Lrp2 T C 2: 69,523,182 D578G probably damaging Het
Lss T G 10: 76,536,289 Y159* probably null Het
Mab21l1 C A 3: 55,783,833 Y280* probably null Het
Maf A T 8: 115,693,170 S378T probably benign Het
Mast2 C T 4: 116,430,519 V59I probably benign Het
Nisch C T 14: 31,180,938 probably benign Het
Nova2 A T 7: 18,957,554 N139Y probably damaging Het
Nup210 C A 6: 91,036,376 D434Y probably damaging Het
Nvl C T 1: 181,109,159 probably null Het
Olfr1049 A T 2: 86,255,241 Y151N probably damaging Het
Olfr1087 A G 2: 86,690,333 V214A possibly damaging Het
Olfr577 A G 7: 102,973,879 Y38H probably damaging Het
Olfr657 A G 7: 104,636,489 T272A probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pbx3 T C 2: 34,204,859 Y255C probably damaging Het
Pcyt1a G A 16: 32,451,793 E27K possibly damaging Het
Pex6 A T 17: 46,714,064 T348S probably benign Het
Phf21b A G 15: 84,797,396 I251T probably damaging Het
Pkd2l2 T C 18: 34,430,702 I490T probably damaging Het
Pla2g12a T A 3: 129,878,885 L56Q probably damaging Het
Plk4 A G 3: 40,806,536 T434A probably benign Het
Ptpn13 A G 5: 103,564,132 N1632S probably benign Het
Rfpl4 C T 7: 5,110,712 V151M probably damaging Het
Rpain G C 11: 70,974,915 E169Q probably damaging Het
Samd8 T A 14: 21,775,159 V124D possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc17a3 T A 13: 23,845,445 V67D probably damaging Het
Slc41a3 G T 6: 90,644,216 V387L probably damaging Het
Slitrk1 T A 14: 108,913,277 M1L probably benign Het
Stat4 T C 1: 52,011,793 W4R probably damaging Het
Tas2r126 A G 6: 42,434,568 T12A probably benign Het
Tbc1d24 A G 17: 24,185,979 C64R probably damaging Het
Tcaf2 T C 6: 42,629,506 S505G probably benign Het
Tiam2 T C 17: 3,516,703 V1506A probably benign Het
Tmem9b A C 7: 109,736,949 S163A probably benign Het
Tmtc2 G A 10: 105,303,658 S669L probably damaging Het
Tnpo3 A T 6: 29,560,221 I641K possibly damaging Het
Ttn C T 2: 76,735,367 A28214T probably damaging Het
Utp11 G A 4: 124,683,239 A113V probably benign Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Vmn1r60 A T 7: 5,544,903 I66N probably benign Het
Zeb2 T C 2: 44,997,194 E572G probably damaging Het
Other mutations in Slc12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Slc12a1 APN 2 125188194 missense probably damaging 1.00
IGL00845:Slc12a1 APN 2 125188238 missense probably damaging 1.00
IGL01348:Slc12a1 APN 2 125194131 missense probably damaging 1.00
IGL01534:Slc12a1 APN 2 125217910 missense probably damaging 1.00
IGL01677:Slc12a1 APN 2 125178149 splice site probably benign
IGL02150:Slc12a1 APN 2 125184815 missense probably damaging 1.00
IGL02220:Slc12a1 APN 2 125188270 critical splice donor site probably null
IGL02568:Slc12a1 APN 2 125184728 missense probably damaging 1.00
IGL02602:Slc12a1 APN 2 125154242 missense probably damaging 1.00
IGL02625:Slc12a1 APN 2 125170691 missense probably damaging 1.00
IGL02635:Slc12a1 APN 2 125225978 missense probably benign
IGL02672:Slc12a1 APN 2 125170676 missense probably damaging 1.00
IGL02718:Slc12a1 APN 2 125161079 nonsense probably null
IGL03191:Slc12a1 APN 2 125206089 missense possibly damaging 0.87
FR4449:Slc12a1 UTSW 2 125154216 small insertion probably benign
FR4548:Slc12a1 UTSW 2 125154214 small insertion probably benign
FR4737:Slc12a1 UTSW 2 125154214 small insertion probably benign
R0033:Slc12a1 UTSW 2 125214009 missense probably benign
R0127:Slc12a1 UTSW 2 125219762 missense probably damaging 1.00
R0312:Slc12a1 UTSW 2 125226028 missense probably damaging 0.98
R0373:Slc12a1 UTSW 2 125226031 missense probably damaging 1.00
R0692:Slc12a1 UTSW 2 125194162 nonsense probably null
R1194:Slc12a1 UTSW 2 125184767 missense probably benign 0.00
R1264:Slc12a1 UTSW 2 125218238 missense possibly damaging 0.56
R1543:Slc12a1 UTSW 2 125184857 missense possibly damaging 0.93
R1940:Slc12a1 UTSW 2 125194193 missense probably benign 0.05
R2109:Slc12a1 UTSW 2 125173699 missense probably damaging 1.00
R2167:Slc12a1 UTSW 2 125173681 missense probably damaging 1.00
R3409:Slc12a1 UTSW 2 125154151 missense probably benign 0.00
R3902:Slc12a1 UTSW 2 125188193 missense probably damaging 1.00
R4079:Slc12a1 UTSW 2 125200623 missense possibly damaging 0.86
R4502:Slc12a1 UTSW 2 125226044 missense probably damaging 1.00
R4557:Slc12a1 UTSW 2 125186641 missense probably damaging 1.00
R4719:Slc12a1 UTSW 2 125153993 missense possibly damaging 0.82
R4782:Slc12a1 UTSW 2 125161079 nonsense probably null
R4845:Slc12a1 UTSW 2 125188226 missense probably damaging 1.00
R4913:Slc12a1 UTSW 2 125228750 missense probably damaging 0.96
R5024:Slc12a1 UTSW 2 125166137 missense probably benign 0.00
R5112:Slc12a1 UTSW 2 125218224 missense possibly damaging 0.63
R5334:Slc12a1 UTSW 2 125217889 missense probably damaging 1.00
R5470:Slc12a1 UTSW 2 125170714 missense probably damaging 1.00
R6057:Slc12a1 UTSW 2 125190213 missense probably damaging 1.00
R6604:Slc12a1 UTSW 2 125184815 missense probably damaging 1.00
R6941:Slc12a1 UTSW 2 125214079 missense possibly damaging 0.85
R6944:Slc12a1 UTSW 2 125160534 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGACAGGACATTCTTCTGCCCACC -3'
(R):5'- TGATGAACTGCCTTGCACACACTAC -3'

Sequencing Primer
(F):5'- CTACAATTTTATGCCAGAGGAGG -3'
(R):5'- CATGTAAGCACACGGAAGC -3'
Posted On2014-04-13