Incidental Mutation 'R1529:Adam11'
ID166481
Institutional Source Beutler Lab
Gene Symbol Adam11
Ensembl Gene ENSMUSG00000020926
Gene Namea disintegrin and metallopeptidase domain 11
SynonymsMdc
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1529 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102761439-102780262 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 102775113 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068150] [ENSMUST00000103081]
Predicted Effect probably null
Transcript: ENSMUST00000068150
SMART Domains Protein: ENSMUSP00000069466
Gene: ENSMUSG00000020926

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 50 193 5.7e-29 PFAM
Pfam:Reprolysin_5 241 390 2.1e-9 PFAM
Pfam:Reprolysin 243 442 1.1e-68 PFAM
Pfam:Reprolysin_3 267 378 1.3e-9 PFAM
DISIN 457 533 3.91e-36 SMART
ACR 534 673 2.76e-56 SMART
EGF 680 714 2.32e-1 SMART
transmembrane domain 740 762 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103081
SMART Domains Protein: ENSMUSP00000099370
Gene: ENSMUSG00000020926

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 193 1.1e-28 PFAM
Pfam:Reprolysin_5 241 390 2.3e-9 PFAM
Pfam:Reprolysin 243 442 5.3e-62 PFAM
Pfam:Reprolysin_3 267 385 4.5e-9 PFAM
DISIN 457 533 3.91e-36 SMART
ACR 534 673 2.76e-56 SMART
EGF 680 714 2.32e-1 SMART
transmembrane domain 740 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143269
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit defects in spatial learning, motor coordination and altered perception of pain. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a targeted disruption of this gene are viable and overtly normal but show impaired hippocampus-dependent spatial learning and cerebellum-dependent motor coordination when tested using water maze and rotating rod tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik G A 17: 47,413,890 S102L probably benign Het
A430105I19Rik T A 2: 118,761,760 probably null Het
AI314180 T C 4: 58,832,701 probably null Het
Amd1 A T 10: 40,290,505 M194K probably benign Het
Ap1b1 T G 11: 5,039,547 F793C probably damaging Het
Arfgef3 G A 10: 18,613,222 R1292* probably null Het
Arhgef5 C A 6: 43,279,515 H1186N probably damaging Het
Atad1 A G 19: 32,706,921 F26L probably benign Het
Atg2b C T 12: 105,661,133 V532I probably benign Het
Atp2b4 A G 1: 133,717,988 F943L probably damaging Het
Atp7b G A 8: 22,028,724 L21F possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Ckmt2 A T 13: 91,861,201 D202E probably benign Het
Crim1 A C 17: 78,367,954 K864T probably benign Het
Ctnnd2 A G 15: 30,887,121 R765G possibly damaging Het
Ddx10 T A 9: 53,117,199 R802* probably null Het
Dnah7b T A 1: 46,177,281 F1152L probably damaging Het
Dsg1c T C 18: 20,282,023 L659P probably damaging Het
Dzank1 A G 2: 144,482,188 F577L probably benign Het
Eci3 T C 13: 34,956,920 D93G probably benign Het
Ep400 C A 5: 110,739,445 V591L probably benign Het
Fam126b A T 1: 58,539,607 D261E probably benign Het
Fgd3 T C 13: 49,266,694 N569S probably benign Het
Ghsr T A 3: 27,372,482 V229E probably damaging Het
Gm8298 T C 3: 59,861,112 I21T probably benign Het
Gna15 T A 10: 81,509,342 I230F probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Grid1 T C 14: 35,309,293 V281A probably benign Het
Hebp2 G A 10: 18,545,761 A12V possibly damaging Het
Hfm1 T C 5: 106,853,123 D1254G probably benign Het
Hif3a A C 7: 17,042,639 S459A probably benign Het
Hnrnpl T A 7: 28,813,923 N149K possibly damaging Het
Hoxc10 A T 15: 102,967,200 S115C probably damaging Het
Ifnab T C 4: 88,691,055 D58G possibly damaging Het
Itfg1 T C 8: 85,810,614 T195A probably benign Het
Itpr3 T A 17: 27,105,485 probably null Het
Iws1 A G 18: 32,080,281 D254G probably benign Het
Kl C A 5: 150,988,941 D718E probably benign Het
Lrit2 A G 14: 37,068,827 I154M probably benign Het
Lrp2 T C 2: 69,523,182 D578G probably damaging Het
Lss T G 10: 76,536,289 Y159* probably null Het
Mab21l1 C A 3: 55,783,833 Y280* probably null Het
Maf A T 8: 115,693,170 S378T probably benign Het
Mast2 C T 4: 116,430,519 V59I probably benign Het
Nisch C T 14: 31,180,938 probably benign Het
Nova2 A T 7: 18,957,554 N139Y probably damaging Het
Nup210 C A 6: 91,036,376 D434Y probably damaging Het
Nvl C T 1: 181,109,159 probably null Het
Olfr1049 A T 2: 86,255,241 Y151N probably damaging Het
Olfr1087 A G 2: 86,690,333 V214A possibly damaging Het
Olfr577 A G 7: 102,973,879 Y38H probably damaging Het
Olfr657 A G 7: 104,636,489 T272A probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pbx3 T C 2: 34,204,859 Y255C probably damaging Het
Pcyt1a G A 16: 32,451,793 E27K possibly damaging Het
Pex6 A T 17: 46,714,064 T348S probably benign Het
Phf21b A G 15: 84,797,396 I251T probably damaging Het
Pkd2l2 T C 18: 34,430,702 I490T probably damaging Het
Pla2g12a T A 3: 129,878,885 L56Q probably damaging Het
Plk4 A G 3: 40,806,536 T434A probably benign Het
Ptpn13 A G 5: 103,564,132 N1632S probably benign Het
Rfpl4 C T 7: 5,110,712 V151M probably damaging Het
Rpain G C 11: 70,974,915 E169Q probably damaging Het
Samd8 T A 14: 21,775,159 V124D possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc12a1 C T 2: 125,190,295 T622I probably damaging Het
Slc17a3 T A 13: 23,845,445 V67D probably damaging Het
Slc41a3 G T 6: 90,644,216 V387L probably damaging Het
Slitrk1 T A 14: 108,913,277 M1L probably benign Het
Stat4 T C 1: 52,011,793 W4R probably damaging Het
Tas2r126 A G 6: 42,434,568 T12A probably benign Het
Tbc1d24 A G 17: 24,185,979 C64R probably damaging Het
Tcaf2 T C 6: 42,629,506 S505G probably benign Het
Tiam2 T C 17: 3,516,703 V1506A probably benign Het
Tmem9b A C 7: 109,736,949 S163A probably benign Het
Tmtc2 G A 10: 105,303,658 S669L probably damaging Het
Tnpo3 A T 6: 29,560,221 I641K possibly damaging Het
Ttn C T 2: 76,735,367 A28214T probably damaging Het
Utp11 G A 4: 124,683,239 A113V probably benign Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Vmn1r60 A T 7: 5,544,903 I66N probably benign Het
Zeb2 T C 2: 44,997,194 E572G probably damaging Het
Other mutations in Adam11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adam11 APN 11 102776831 missense probably benign 0.40
IGL00497:Adam11 APN 11 102770147 missense probably damaging 1.00
IGL00570:Adam11 APN 11 102776350 missense possibly damaging 0.76
IGL01875:Adam11 APN 11 102772856 missense probably damaging 1.00
IGL01945:Adam11 APN 11 102772910 missense probably damaging 0.99
IGL02266:Adam11 APN 11 102772667 missense probably damaging 1.00
IGL02702:Adam11 APN 11 102777038 missense probably benign 0.26
IGL03395:Adam11 APN 11 102772920 missense probably damaging 1.00
R0091:Adam11 UTSW 11 102772839 missense probably damaging 1.00
R0135:Adam11 UTSW 11 102776573 missense probably damaging 1.00
R1068:Adam11 UTSW 11 102776378 missense probably damaging 1.00
R2197:Adam11 UTSW 11 102769924 missense possibly damaging 0.94
R2357:Adam11 UTSW 11 102774508 missense probably benign
R3082:Adam11 UTSW 11 102770117 splice site probably benign
R3784:Adam11 UTSW 11 102774367 critical splice donor site probably null
R5254:Adam11 UTSW 11 102774272 nonsense probably null
R5367:Adam11 UTSW 11 102773653 missense probably benign 0.00
R5444:Adam11 UTSW 11 102772848 missense probably damaging 1.00
R5699:Adam11 UTSW 11 102773640 missense probably benign 0.00
R5881:Adam11 UTSW 11 102773810 missense probably benign 0.17
R6193:Adam11 UTSW 11 102771261 missense probably benign
R6422:Adam11 UTSW 11 102774283 missense possibly damaging 0.95
R6798:Adam11 UTSW 11 102777008 missense probably damaging 1.00
R6822:Adam11 UTSW 11 102776675 missense possibly damaging 0.68
X0023:Adam11 UTSW 11 102774630 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAATGCACCTTGACGCACGACG -3'
(R):5'- GAATACACTAGACACTGGGCAGGC -3'

Sequencing Primer
(F):5'- CGATTGGATGCCCTCGATAAG -3'
(R):5'- CGGTAGGAATACCAGTGTCAC -3'
Posted On2014-04-13