Incidental Mutation 'R1530:Il1r1'
ID166513
Institutional Source Beutler Lab
Gene Symbol Il1r1
Ensembl Gene ENSMUSG00000026072
Gene Nameinterleukin 1 receptor, type I
SynonymsIL-1R1, IL-iR, CD121a, IL-1 receptor alpha chain, Il1r-1
MMRRC Submission 039569-MU
Accession Numbers

Genbank: NM_008362, NM_001123382

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1530 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location40225080-40317257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40312361 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 384 (T384A)
Ref Sequence ENSEMBL: ENSMUSP00000110443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027241] [ENSMUST00000114795]
Predicted Effect probably benign
Transcript: ENSMUST00000027241
AA Change: T387A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027241
Gene: ENSMUSG00000026072
AA Change: T387A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 38 117 2.94e-1 SMART
IG_like 132 218 5.56e0 SMART
IG 236 333 1.35e0 SMART
Blast:TIR 347 381 1e-7 BLAST
TIR 387 544 1.93e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114795
AA Change: T384A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000110443
Gene: ENSMUSG00000026072
AA Change: T384A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 35 114 2.94e-1 SMART
IG_like 129 215 5.56e0 SMART
IG 233 330 1.35e0 SMART
Blast:TIR 344 378 1e-7 BLAST
TIR 384 541 1.93e-29 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine receptor that belongs to the interleukin-1 receptor family. The encoded protein is a receptor for interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist. It is an important mediator involved in many cytokine-induced immune and inflammatory responses. This gene is located in a cluster of related cytokine receptor genes on chromosome 2q12. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, reduced IL1b responsiveness, delayed tooth eruption, decreased susceptibility to experimental autoimmune uveoritinitis, decreased susceptibility to kidney reperfusion injury, and late onset obesity. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Gene trapped(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,569,378 C425R probably damaging Het
Adam15 A G 3: 89,349,830 S20P probably damaging Het
Adgra3 G A 5: 49,961,137 T1023I probably benign Het
Angel2 T A 1: 190,939,088 V46E probably damaging Het
Ankrd13c T A 3: 157,991,721 M321K probably damaging Het
Atad2b C T 12: 4,942,018 R206* probably null Het
Atp10b T A 11: 43,197,524 F319Y probably benign Het
AW554918 A G 18: 25,400,104 R272G probably damaging Het
BC027072 A G 17: 71,749,478 V1068A probably benign Het
Bpi T A 2: 158,261,145 I70N probably damaging Het
Brca1 T C 11: 101,524,695 D871G probably damaging Het
Capn3 G A 2: 120,482,208 A160T probably damaging Het
Cenpe T C 3: 135,246,902 L1451P possibly damaging Het
Chmp7 A G 14: 69,732,488 M1T probably null Het
Csrnp1 G C 9: 119,973,546 Q200E possibly damaging Het
Dscam G A 16: 96,819,874 P545S probably damaging Het
Erap1 A G 13: 74,646,543 E107G probably benign Het
Errfi1 A G 4: 150,865,386 I49V probably benign Het
Fam160b1 T A 19: 57,386,305 I704N probably damaging Het
Fam171b T C 2: 83,880,189 L735S probably damaging Het
Fancm T A 12: 65,092,490 probably null Het
Fbp2 G C 13: 62,837,159 P316R probably damaging Het
Fcer2a C A 8: 3,682,976 G255V probably damaging Het
Fzd2 T C 11: 102,605,308 S193P probably benign Het
Gak A G 5: 108,624,193 V86A probably damaging Het
Gas2l3 A G 10: 89,433,769 I7T probably benign Het
Gbp11 T C 5: 105,327,489 H331R probably damaging Het
Gpr19 C T 6: 134,869,998 V241M probably damaging Het
Grk6 G A 13: 55,458,799 A437T probably damaging Het
Hip1 T C 5: 135,444,780 D253G probably damaging Het
Ifna9 G C 4: 88,592,172 Q72E possibly damaging Het
Ip6k1 C A 9: 108,045,562 C221* probably null Het
Kcna1 C A 6: 126,642,531 E275D probably benign Het
Kcnt2 C T 1: 140,484,232 Q468* probably null Het
Kin T C 2: 10,092,339 V333A probably damaging Het
Leprot G T 4: 101,656,287 V91L probably benign Het
Mettl21c A G 1: 44,017,184 probably null Het
Myom2 T C 8: 15,122,384 F1161S probably damaging Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nipal2 A T 15: 34,625,022 *72K probably null Het
Nol3 T C 8: 105,279,226 V84A probably benign Het
Olfr1188 A T 2: 88,559,483 I5F probably benign Het
Olfr1388 C T 11: 49,443,905 S18L probably benign Het
Olfr901 T C 9: 38,430,324 I14T probably damaging Het
Pdgfra T A 5: 75,189,010 probably null Het
Pik3cb T C 9: 99,053,973 D802G probably damaging Het
Plac8l1 A T 18: 42,178,931 V141E probably damaging Het
Plxnb2 A G 15: 89,167,192 S275P probably benign Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rapgef6 T A 11: 54,661,183 I959K probably damaging Het
Scn5a T C 9: 119,495,562 K1400R probably damaging Het
Sel1l A G 12: 91,826,684 S263P probably damaging Het
Setd5 G A 6: 113,109,913 V34I probably damaging Het
Slc17a2 A G 13: 23,819,069 D234G probably damaging Het
Spink5 T A 18: 44,015,671 S934T probably damaging Het
St18 A C 1: 6,845,569 probably null Het
St3gal4 T C 9: 35,052,296 I239V probably benign Het
Stag3 C T 5: 138,297,412 T399I probably damaging Het
Syt11 T C 3: 88,762,367 K6E probably damaging Het
Taf15 T C 11: 83,487,296 Y121H possibly damaging Het
Tdh T C 14: 63,496,055 Y113C probably damaging Het
Tgfbr1 T A 4: 47,410,688 W406R probably damaging Het
Tgm6 A G 2: 130,151,282 I563V possibly damaging Het
Tmem131 A G 1: 36,827,009 probably null Het
Tmub2 T C 11: 102,287,486 S72P probably benign Het
Trappc13 G A 13: 104,150,143 T202I probably damaging Het
Trim9 T C 12: 70,272,428 E449G probably damaging Het
Trip11 C A 12: 101,912,767 G21V unknown Het
Ttll12 G A 15: 83,588,655 R127C probably damaging Het
Vmn2r125 A T 4: 156,351,152 Y275F probably damaging Het
Xrcc5 A G 1: 72,329,944 D319G probably damaging Het
Zc3h14 T G 12: 98,785,003 C159W probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfhx3 C T 8: 108,948,489 P2057L probably damaging Het
Other mutations in Il1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Il1r1 APN 1 40313170 missense probably damaging 1.00
IGL01532:Il1r1 APN 1 40294928 critical splice donor site probably null
IGL01610:Il1r1 APN 1 40302400 missense probably benign 0.09
IGL01668:Il1r1 APN 1 40313329 missense probably benign 0.31
IGL01729:Il1r1 APN 1 40294826 missense probably damaging 1.00
IGL02201:Il1r1 APN 1 40313268 missense probably damaging 0.97
IGL02229:Il1r1 APN 1 40313358 missense probably damaging 0.99
IGL02428:Il1r1 APN 1 40313232 missense possibly damaging 0.74
IGL02902:Il1r1 APN 1 40302409 missense probably benign 0.09
G5030:Il1r1 UTSW 1 40313163 missense possibly damaging 0.80
R0604:Il1r1 UTSW 1 40282246 missense probably benign 0.36
R1515:Il1r1 UTSW 1 40293349 nonsense probably null
R1727:Il1r1 UTSW 1 40293264 missense probably benign 0.16
R1957:Il1r1 UTSW 1 40313140 nonsense probably null
R2163:Il1r1 UTSW 1 40294863 missense probably benign 0.00
R2313:Il1r1 UTSW 1 40313310 missense probably benign 0.19
R4345:Il1r1 UTSW 1 40297924 missense probably benign 0.00
R4622:Il1r1 UTSW 1 40312420 missense probably damaging 0.96
R4735:Il1r1 UTSW 1 40293295 missense probably benign 0.00
R5033:Il1r1 UTSW 1 40293524 missense probably damaging 1.00
R5586:Il1r1 UTSW 1 40225251 start gained probably benign
R6375:Il1r1 UTSW 1 40294890 missense probably damaging 1.00
R6383:Il1r1 UTSW 1 40313335 missense possibly damaging 0.58
R6618:Il1r1 UTSW 1 40300811 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCGCGTTGCTCTCTAAGCTTTG -3'
(R):5'- ACCCACGAAAGACGGACTTTGC -3'

Sequencing Primer
(F):5'- GTTGCTCTCTAAGCTTTGGAAAC -3'
(R):5'- AGACGGACTTTGCTCTTAGAACC -3'
Posted On2014-04-13