Incidental Mutation 'R1530:Ndor1'
ID166519
Institutional Source Beutler Lab
Gene Symbol Ndor1
Ensembl Gene ENSMUSG00000006471
Gene NameNADPH dependent diflavin oxidoreductase 1
SynonymsNR1, 4930447P04Rik
MMRRC Submission 039569-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R1530 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25244821-25256022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25248909 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 321 (L321P)
Ref Sequence ENSEMBL: ENSMUSP00000154261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060818] [ENSMUST00000100329] [ENSMUST00000114349] [ENSMUST00000114355] [ENSMUST00000132128] [ENSMUST00000147866] [ENSMUST00000148589] [ENSMUST00000228052] [ENSMUST00000228627]
Predicted Effect probably benign
Transcript: ENSMUST00000060818
SMART Domains Protein: ENSMUSP00000057742
Gene: ENSMUSG00000044628

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
RING 147 193 1.11e-2 SMART
low complexity region 227 238 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100329
AA Change: L323P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097903
Gene: ENSMUSG00000006471
AA Change: L323P

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 124 2.3e-23 PFAM
Pfam:FAD_binding_1 134 354 8e-50 PFAM
Pfam:NAD_binding_1 389 495 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114349
AA Change: L390P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109989
Gene: ENSMUSG00000006471
AA Change: L390P

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 145 2.3e-32 PFAM
Pfam:FAD_binding_1 201 421 2e-48 PFAM
Pfam:NAD_binding_1 456 561 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114355
SMART Domains Protein: ENSMUSP00000109995
Gene: ENSMUSG00000044628

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
RING 147 193 1.11e-2 SMART
low complexity region 227 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129705
Predicted Effect probably benign
Transcript: ENSMUST00000132128
SMART Domains Protein: ENSMUSP00000125018
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 48 2e-9 PDB
SCOP:d1f4pa_ 4 57 4e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137355
Predicted Effect probably benign
Transcript: ENSMUST00000141808
SMART Domains Protein: ENSMUSP00000123247
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 7 120 8.1e-25 PFAM
Pfam:FAD_binding_1 167 225 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147866
SMART Domains Protein: ENSMUSP00000125259
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Pfam:Flavodoxin_1 93 196 4.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148589
SMART Domains Protein: ENSMUSP00000123958
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 49 7e-10 PDB
SCOP:d1f4pa_ 4 45 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228052
AA Change: L321P

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000228627
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an NADPH-dependent diflavin reductase that contains both flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) binding domains. The encoded protein catalyzes the transfer of electrons from NADPH through FAD and FMN cofactors to potential redox partners. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,569,378 C425R probably damaging Het
Adam15 A G 3: 89,349,830 S20P probably damaging Het
Adgra3 G A 5: 49,961,137 T1023I probably benign Het
Angel2 T A 1: 190,939,088 V46E probably damaging Het
Ankrd13c T A 3: 157,991,721 M321K probably damaging Het
Atad2b C T 12: 4,942,018 R206* probably null Het
Atp10b T A 11: 43,197,524 F319Y probably benign Het
AW554918 A G 18: 25,400,104 R272G probably damaging Het
BC027072 A G 17: 71,749,478 V1068A probably benign Het
Bpi T A 2: 158,261,145 I70N probably damaging Het
Brca1 T C 11: 101,524,695 D871G probably damaging Het
Capn3 G A 2: 120,482,208 A160T probably damaging Het
Cenpe T C 3: 135,246,902 L1451P possibly damaging Het
Chmp7 A G 14: 69,732,488 M1T probably null Het
Csrnp1 G C 9: 119,973,546 Q200E possibly damaging Het
Dscam G A 16: 96,819,874 P545S probably damaging Het
Erap1 A G 13: 74,646,543 E107G probably benign Het
Errfi1 A G 4: 150,865,386 I49V probably benign Het
Fam160b1 T A 19: 57,386,305 I704N probably damaging Het
Fam171b T C 2: 83,880,189 L735S probably damaging Het
Fancm T A 12: 65,092,490 probably null Het
Fbp2 G C 13: 62,837,159 P316R probably damaging Het
Fcer2a C A 8: 3,682,976 G255V probably damaging Het
Fzd2 T C 11: 102,605,308 S193P probably benign Het
Gak A G 5: 108,624,193 V86A probably damaging Het
Gas2l3 A G 10: 89,433,769 I7T probably benign Het
Gbp11 T C 5: 105,327,489 H331R probably damaging Het
Gpr19 C T 6: 134,869,998 V241M probably damaging Het
Grk6 G A 13: 55,458,799 A437T probably damaging Het
Hip1 T C 5: 135,444,780 D253G probably damaging Het
Ifna9 G C 4: 88,592,172 Q72E possibly damaging Het
Il1r1 A G 1: 40,312,361 T384A probably benign Het
Ip6k1 C A 9: 108,045,562 C221* probably null Het
Kcna1 C A 6: 126,642,531 E275D probably benign Het
Kcnt2 C T 1: 140,484,232 Q468* probably null Het
Kin T C 2: 10,092,339 V333A probably damaging Het
Leprot G T 4: 101,656,287 V91L probably benign Het
Mettl21c A G 1: 44,017,184 probably null Het
Myom2 T C 8: 15,122,384 F1161S probably damaging Het
Nipal2 A T 15: 34,625,022 *72K probably null Het
Nol3 T C 8: 105,279,226 V84A probably benign Het
Olfr1188 A T 2: 88,559,483 I5F probably benign Het
Olfr1388 C T 11: 49,443,905 S18L probably benign Het
Olfr901 T C 9: 38,430,324 I14T probably damaging Het
Pdgfra T A 5: 75,189,010 probably null Het
Pik3cb T C 9: 99,053,973 D802G probably damaging Het
Plac8l1 A T 18: 42,178,931 V141E probably damaging Het
Plxnb2 A G 15: 89,167,192 S275P probably benign Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rapgef6 T A 11: 54,661,183 I959K probably damaging Het
Scn5a T C 9: 119,495,562 K1400R probably damaging Het
Sel1l A G 12: 91,826,684 S263P probably damaging Het
Setd5 G A 6: 113,109,913 V34I probably damaging Het
Slc17a2 A G 13: 23,819,069 D234G probably damaging Het
Spink5 T A 18: 44,015,671 S934T probably damaging Het
St18 A C 1: 6,845,569 probably null Het
St3gal4 T C 9: 35,052,296 I239V probably benign Het
Stag3 C T 5: 138,297,412 T399I probably damaging Het
Syt11 T C 3: 88,762,367 K6E probably damaging Het
Taf15 T C 11: 83,487,296 Y121H possibly damaging Het
Tdh T C 14: 63,496,055 Y113C probably damaging Het
Tgfbr1 T A 4: 47,410,688 W406R probably damaging Het
Tgm6 A G 2: 130,151,282 I563V possibly damaging Het
Tmem131 A G 1: 36,827,009 probably null Het
Tmub2 T C 11: 102,287,486 S72P probably benign Het
Trappc13 G A 13: 104,150,143 T202I probably damaging Het
Trim9 T C 12: 70,272,428 E449G probably damaging Het
Trip11 C A 12: 101,912,767 G21V unknown Het
Ttll12 G A 15: 83,588,655 R127C probably damaging Het
Vmn2r125 A T 4: 156,351,152 Y275F probably damaging Het
Xrcc5 A G 1: 72,329,944 D319G probably damaging Het
Zc3h14 T G 12: 98,785,003 C159W probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfhx3 C T 8: 108,948,489 P2057L probably damaging Het
Other mutations in Ndor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Ndor1 APN 2 25250139 missense probably benign 0.05
IGL02174:Ndor1 APN 2 25249194 missense possibly damaging 0.49
IGL02366:Ndor1 APN 2 25247981 missense possibly damaging 0.94
IGL02407:Ndor1 APN 2 25249269 missense probably benign 0.39
IGL02630:Ndor1 APN 2 25255287 missense probably damaging 1.00
R0139:Ndor1 UTSW 2 25248354 missense possibly damaging 0.90
R0194:Ndor1 UTSW 2 25248706 unclassified probably null
R0926:Ndor1 UTSW 2 25248348 missense probably benign 0.08
R1533:Ndor1 UTSW 2 25249267 missense probably damaging 0.98
R1837:Ndor1 UTSW 2 25248396 missense probably damaging 1.00
R1954:Ndor1 UTSW 2 25255293 missense possibly damaging 0.86
R1981:Ndor1 UTSW 2 25255224 missense probably damaging 0.97
R2090:Ndor1 UTSW 2 25249218 missense probably damaging 1.00
R2188:Ndor1 UTSW 2 25251753 unclassified probably null
R3433:Ndor1 UTSW 2 25247811 missense possibly damaging 0.91
R3620:Ndor1 UTSW 2 25248035 missense probably damaging 1.00
R4013:Ndor1 UTSW 2 25250150 missense probably damaging 0.98
R4411:Ndor1 UTSW 2 25248480 missense probably benign 0.08
R4457:Ndor1 UTSW 2 25248116 unclassified probably null
R4942:Ndor1 UTSW 2 25248121 critical splice donor site probably null
R5132:Ndor1 UTSW 2 25247769 missense probably benign 0.28
R6476:Ndor1 UTSW 2 25248142 missense possibly damaging 0.95
R6702:Ndor1 UTSW 2 25249890 missense possibly damaging 0.95
R6703:Ndor1 UTSW 2 25249890 missense possibly damaging 0.95
X0018:Ndor1 UTSW 2 25247844 missense probably benign 0.03
X0019:Ndor1 UTSW 2 25248181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCACAAGGATCTGTAGCCTC -3'
(R):5'- TACTTGGACATTGCCAGTGTGCCC -3'

Sequencing Primer
(F):5'- CCTGGGATGAGCCTATGGAC -3'
(R):5'- CCGCAGAACCATCTTGGAG -3'
Posted On2014-04-13