Incidental Mutation 'R1530:Zfhx3'
ID166552
Institutional Source Beutler Lab
Gene Symbol Zfhx3
Ensembl Gene ENSMUSG00000038872
Gene Namezinc finger homeobox 3
SynonymsA230102L03Rik, Atbf1, WBP9
MMRRC Submission 039569-MU
Accession Numbers

Genbank: NM_007496

Is this an essential gene? Probably essential (E-score: 0.826) question?
Stock #R1530 (G1)
Quality Score172
Status Not validated
Chromosome8
Chromosomal Location107942644-108961630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108948489 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 2057 (P2057L)
Ref Sequence ENSEMBL: ENSMUSP00000152353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043896] [ENSMUST00000220518]
Predicted Effect probably damaging
Transcript: ENSMUST00000043896
AA Change: P2057L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044612
Gene: ENSMUSG00000038872
AA Change: P2057L

DomainStartEndE-ValueType
ZnF_C2H2 79 103 7.89e0 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
ZnF_C2H2 282 305 1.36e1 SMART
low complexity region 393 411 N/A INTRINSIC
coiled coil region 453 496 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
ZnF_C2H2 641 664 3.47e0 SMART
ZnF_C2H2 672 695 6.78e-3 SMART
ZnF_U1 724 758 5.71e-1 SMART
ZnF_C2H2 727 751 4.87e-4 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 796 804 N/A INTRINSIC
ZnF_C2H2 805 829 6.67e-2 SMART
ZnF_U1 982 1016 2.35e0 SMART
ZnF_C2H2 985 1009 4.57e0 SMART
ZnF_C2H2 1041 1065 3.99e0 SMART
ZnF_U1 1086 1120 1.36e0 SMART
ZnF_C2H2 1089 1113 1.33e-1 SMART
ZnF_C2H2 1233 1256 4.11e-2 SMART
ZnF_C2H2 1262 1285 4.34e-1 SMART
ZnF_C2H2 1370 1395 1.08e-1 SMART
ZnF_C2H2 1411 1433 3.34e-2 SMART
ZnF_C2H2 1439 1462 8.09e-1 SMART
low complexity region 1500 1512 N/A INTRINSIC
ZnF_U1 1552 1586 1.05e0 SMART
ZnF_C2H2 1555 1579 8.22e-2 SMART
ZnF_U1 1603 1637 4.19e0 SMART
ZnF_C2H2 1606 1630 1.16e-1 SMART
low complexity region 1643 1669 N/A INTRINSIC
low complexity region 1734 1776 N/A INTRINSIC
low complexity region 1792 1802 N/A INTRINSIC
low complexity region 1842 1878 N/A INTRINSIC
low complexity region 1881 1894 N/A INTRINSIC
low complexity region 1967 1985 N/A INTRINSIC
ZnF_C2H2 1990 2013 1.62e0 SMART
low complexity region 2041 2088 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
HOX 2152 2214 1.13e-16 SMART
HOX 2249 2311 2.41e-20 SMART
ZnF_C2H2 2335 2355 1.72e1 SMART
low complexity region 2383 2414 N/A INTRINSIC
low complexity region 2458 2473 N/A INTRINSIC
low complexity region 2476 2521 N/A INTRINSIC
ZnF_C2H2 2539 2561 1.79e-2 SMART
low complexity region 2606 2619 N/A INTRINSIC
HOX 2650 2712 2.97e-20 SMART
ZnF_C2H2 2720 2743 7.67e-2 SMART
low complexity region 2929 2950 N/A INTRINSIC
HOX 2954 3016 1.07e-17 SMART
ZnF_U1 3029 3063 1.8e-1 SMART
ZnF_C2H2 3032 3056 8.31e0 SMART
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3181 3235 N/A INTRINSIC
low complexity region 3237 3256 N/A INTRINSIC
low complexity region 3268 3282 N/A INTRINSIC
low complexity region 3290 3299 N/A INTRINSIC
coiled coil region 3362 3417 N/A INTRINSIC
low complexity region 3452 3476 N/A INTRINSIC
ZnF_C2H2 3489 3509 1.45e2 SMART
ZnF_U1 3546 3580 1.36e0 SMART
ZnF_C2H2 3549 3573 1.77e1 SMART
low complexity region 3602 3633 N/A INTRINSIC
low complexity region 3642 3674 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220518
AA Change: P2057L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal initial pituitary development but reduced GH and TSH-beta staining within the pituitary by E17.5. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice heterozygous for the same allele exhibit partial postnatal lethality, decreased body size and prolonged conception time. [provided by MGI curators]
Allele List at MGI

 All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,569,378 C425R probably damaging Het
Adam15 A G 3: 89,349,830 S20P probably damaging Het
Adgra3 G A 5: 49,961,137 T1023I probably benign Het
Angel2 T A 1: 190,939,088 V46E probably damaging Het
Ankrd13c T A 3: 157,991,721 M321K probably damaging Het
Atad2b C T 12: 4,942,018 R206* probably null Het
Atp10b T A 11: 43,197,524 F319Y probably benign Het
AW554918 A G 18: 25,400,104 R272G probably damaging Het
BC027072 A G 17: 71,749,478 V1068A probably benign Het
Bpi T A 2: 158,261,145 I70N probably damaging Het
Brca1 T C 11: 101,524,695 D871G probably damaging Het
Capn3 G A 2: 120,482,208 A160T probably damaging Het
Cenpe T C 3: 135,246,902 L1451P possibly damaging Het
Chmp7 A G 14: 69,732,488 M1T probably null Het
Csrnp1 G C 9: 119,973,546 Q200E possibly damaging Het
Dscam G A 16: 96,819,874 P545S probably damaging Het
Erap1 A G 13: 74,646,543 E107G probably benign Het
Errfi1 A G 4: 150,865,386 I49V probably benign Het
Fam160b1 T A 19: 57,386,305 I704N probably damaging Het
Fam171b T C 2: 83,880,189 L735S probably damaging Het
Fancm T A 12: 65,092,490 probably null Het
Fbp2 G C 13: 62,837,159 P316R probably damaging Het
Fcer2a C A 8: 3,682,976 G255V probably damaging Het
Fzd2 T C 11: 102,605,308 S193P probably benign Het
Gak A G 5: 108,624,193 V86A probably damaging Het
Gas2l3 A G 10: 89,433,769 I7T probably benign Het
Gbp11 T C 5: 105,327,489 H331R probably damaging Het
Gpr19 C T 6: 134,869,998 V241M probably damaging Het
Grk6 G A 13: 55,458,799 A437T probably damaging Het
Hip1 T C 5: 135,444,780 D253G probably damaging Het
Ifna9 G C 4: 88,592,172 Q72E possibly damaging Het
Il1r1 A G 1: 40,312,361 T384A probably benign Het
Ip6k1 C A 9: 108,045,562 C221* probably null Het
Kcna1 C A 6: 126,642,531 E275D probably benign Het
Kcnt2 C T 1: 140,484,232 Q468* probably null Het
Kin T C 2: 10,092,339 V333A probably damaging Het
Leprot G T 4: 101,656,287 V91L probably benign Het
Mettl21c A G 1: 44,017,184 probably null Het
Myom2 T C 8: 15,122,384 F1161S probably damaging Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nipal2 A T 15: 34,625,022 *72K probably null Het
Nol3 T C 8: 105,279,226 V84A probably benign Het
Olfr1188 A T 2: 88,559,483 I5F probably benign Het
Olfr1388 C T 11: 49,443,905 S18L probably benign Het
Olfr901 T C 9: 38,430,324 I14T probably damaging Het
Pdgfra T A 5: 75,189,010 probably null Het
Pik3cb T C 9: 99,053,973 D802G probably damaging Het
Plac8l1 A T 18: 42,178,931 V141E probably damaging Het
Plxnb2 A G 15: 89,167,192 S275P probably benign Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rapgef6 T A 11: 54,661,183 I959K probably damaging Het
Scn5a T C 9: 119,495,562 K1400R probably damaging Het
Sel1l A G 12: 91,826,684 S263P probably damaging Het
Setd5 G A 6: 113,109,913 V34I probably damaging Het
Slc17a2 A G 13: 23,819,069 D234G probably damaging Het
Spink5 T A 18: 44,015,671 S934T probably damaging Het
St18 A C 1: 6,845,569 probably null Het
St3gal4 T C 9: 35,052,296 I239V probably benign Het
Stag3 C T 5: 138,297,412 T399I probably damaging Het
Syt11 T C 3: 88,762,367 K6E probably damaging Het
Taf15 T C 11: 83,487,296 Y121H possibly damaging Het
Tdh T C 14: 63,496,055 Y113C probably damaging Het
Tgfbr1 T A 4: 47,410,688 W406R probably damaging Het
Tgm6 A G 2: 130,151,282 I563V possibly damaging Het
Tmem131 A G 1: 36,827,009 probably null Het
Tmub2 T C 11: 102,287,486 S72P probably benign Het
Trappc13 G A 13: 104,150,143 T202I probably damaging Het
Trim9 T C 12: 70,272,428 E449G probably damaging Het
Trip11 C A 12: 101,912,767 G21V unknown Het
Ttll12 G A 15: 83,588,655 R127C probably damaging Het
Vmn2r125 A T 4: 156,351,152 Y275F probably damaging Het
Xrcc5 A G 1: 72,329,944 D319G probably damaging Het
Zc3h14 T G 12: 98,785,003 C159W probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Other mutations in Zfhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Zfhx3 APN 8 108793594 missense probably benign 0.00
IGL01946:Zfhx3 APN 8 108933929 missense probably damaging 0.98
IGL01973:Zfhx3 APN 8 108947193 missense probably damaging 1.00
IGL01983:Zfhx3 APN 8 108947234 missense probably damaging 1.00
IGL02151:Zfhx3 APN 8 108793883 missense probably damaging 1.00
IGL02405:Zfhx3 APN 8 108955742 missense unknown
IGL02406:Zfhx3 APN 8 108955742 missense unknown
IGL02408:Zfhx3 APN 8 108955372 splice site probably benign
IGL02549:Zfhx3 APN 8 108800509 missense probably damaging 1.00
IGL02601:Zfhx3 APN 8 108856830 missense probably damaging 1.00
IGL02649:Zfhx3 APN 8 108793535 missense possibly damaging 0.94
IGL03027:Zfhx3 APN 8 108793188 missense probably damaging 0.98
IGL03053:Zfhx3 APN 8 108946500 missense probably damaging 0.99
IGL03168:Zfhx3 APN 8 108946500 missense probably damaging 0.99
IGL03194:Zfhx3 APN 8 108794727 missense probably damaging 0.97
IGL03248:Zfhx3 APN 8 108946550 missense probably damaging 1.00
FR4449:Zfhx3 UTSW 8 108956094 small insertion probably benign
FR4589:Zfhx3 UTSW 8 108956101 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956088 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956102 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956103 small insertion probably benign
G5030:Zfhx3 UTSW 8 108951459 missense possibly damaging 0.86
R0016:Zfhx3 UTSW 8 108950178 missense probably benign 0.02
R0090:Zfhx3 UTSW 8 108950057 missense possibly damaging 0.85
R0330:Zfhx3 UTSW 8 108948957 missense probably damaging 1.00
R0332:Zfhx3 UTSW 8 108946623 missense probably damaging 1.00
R0398:Zfhx3 UTSW 8 108951246 missense probably damaging 0.98
R0539:Zfhx3 UTSW 8 108800509 missense probably damaging 1.00
R0546:Zfhx3 UTSW 8 108794187 missense probably damaging 1.00
R0614:Zfhx3 UTSW 8 108948539 missense probably benign 0.03
R0614:Zfhx3 UTSW 8 108948967 nonsense probably null
R0653:Zfhx3 UTSW 8 108946808 missense possibly damaging 0.95
R0718:Zfhx3 UTSW 8 108955650 missense unknown
R0825:Zfhx3 UTSW 8 108949208 missense probably damaging 0.99
R1143:Zfhx3 UTSW 8 108794411 missense probably damaging 1.00
R1319:Zfhx3 UTSW 8 108933833 missense probably damaging 0.99
R1347:Zfhx3 UTSW 8 108800698 splice site probably benign
R1412:Zfhx3 UTSW 8 108914567 missense possibly damaging 0.88
R1447:Zfhx3 UTSW 8 108948444 missense probably benign 0.03
R1745:Zfhx3 UTSW 8 108955862 missense unknown
R1764:Zfhx3 UTSW 8 108951644 missense probably benign 0.18
R1781:Zfhx3 UTSW 8 108793535 missense probably benign 0.01
R1917:Zfhx3 UTSW 8 108956248 missense unknown
R1956:Zfhx3 UTSW 8 108794142 missense probably benign 0.02
R2049:Zfhx3 UTSW 8 108945177 missense probably benign 0.01
R2196:Zfhx3 UTSW 8 108800253 missense probably damaging 1.00
R3085:Zfhx3 UTSW 8 108956032 missense unknown
R3765:Zfhx3 UTSW 8 108792762 missense probably damaging 0.97
R4162:Zfhx3 UTSW 8 108956987 missense unknown
R4243:Zfhx3 UTSW 8 108792320 missense probably damaging 0.97
R4380:Zfhx3 UTSW 8 108956390 missense unknown
R4433:Zfhx3 UTSW 8 108955637 missense unknown
R4509:Zfhx3 UTSW 8 108793779 missense probably benign 0.01
R4731:Zfhx3 UTSW 8 108956084 missense unknown
R4788:Zfhx3 UTSW 8 108794210 missense probably damaging 1.00
R4812:Zfhx3 UTSW 8 108947961 missense possibly damaging 0.83
R4893:Zfhx3 UTSW 8 108957007 missense unknown
R4907:Zfhx3 UTSW 8 108793354 missense probably damaging 0.99
R4935:Zfhx3 UTSW 8 108947850 missense possibly damaging 0.92
R4943:Zfhx3 UTSW 8 108948317 missense probably damaging 0.98
R5154:Zfhx3 UTSW 8 108800575 missense probably damaging 1.00
R5377:Zfhx3 UTSW 8 108951185 missense possibly damaging 0.95
R5388:Zfhx3 UTSW 8 108946814 missense possibly damaging 0.88
R5434:Zfhx3 UTSW 8 108792399 missense probably damaging 0.99
R5445:Zfhx3 UTSW 8 108956210 missense unknown
R5541:Zfhx3 UTSW 8 108948951 missense probably damaging 0.99
R5571:Zfhx3 UTSW 8 108955991 missense unknown
R5700:Zfhx3 UTSW 8 108933867 missense probably damaging 1.00
R5754:Zfhx3 UTSW 8 108800332 missense probably damaging 0.99
R5867:Zfhx3 UTSW 8 108793446 missense probably damaging 1.00
R5905:Zfhx3 UTSW 8 108793503 missense probably damaging 1.00
R5922:Zfhx3 UTSW 8 108946698 missense probably damaging 1.00
R5972:Zfhx3 UTSW 8 108950851 missense possibly damaging 0.91
R6020:Zfhx3 UTSW 8 108792527 missense probably damaging 1.00
R6028:Zfhx3 UTSW 8 108793503 missense probably damaging 1.00
R6113:Zfhx3 UTSW 8 108947421 missense probably benign 0.04
R6253:Zfhx3 UTSW 8 108955388 missense possibly damaging 0.96
R6356:Zfhx3 UTSW 8 108946619 missense probably damaging 1.00
R6800:Zfhx3 UTSW 8 108949517 missense probably benign 0.20
R6829:Zfhx3 UTSW 8 108950283 missense probably damaging 0.98
R6872:Zfhx3 UTSW 8 108800641 missense probably damaging 1.00
R6873:Zfhx3 UTSW 8 108800641 missense probably damaging 1.00
R6919:Zfhx3 UTSW 8 108800528 missense probably damaging 1.00
R6921:Zfhx3 UTSW 8 108951392 missense possibly damaging 0.53
R6925:Zfhx3 UTSW 8 108956821 missense unknown
R6927:Zfhx3 UTSW 8 108956821 missense unknown
R7152:Zfhx3 UTSW 8 108948207 missense not run
X0019:Zfhx3 UTSW 8 108951653 missense probably benign 0.00
X0026:Zfhx3 UTSW 8 108949145 missense probably damaging 1.00
Z1088:Zfhx3 UTSW 8 108951357 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ATTCTGAAGAGCCACCAGGAGCAC -3'
(R):5'- AATGTCGAAGTACTGCCTGAGCAC -3'

Sequencing Primer
(F):5'- ACGTGCATCAGAACTACTTCC -3'
(R):5'- AGCTGGTCATCCGTGATCC -3'
Posted On2014-04-13