Incidental Mutation 'R1530:Csrnp1'
ID166558
Institutional Source Beutler Lab
Gene Symbol Csrnp1
Ensembl Gene ENSMUSG00000032515
Gene Namecysteine-serine-rich nuclear protein 1
Synonyms4931429D10Rik, taip-3, CSRNP-1, Axud1
MMRRC Submission 039569-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1530 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119971163-119984658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 119973546 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 200 (Q200E)
Ref Sequence ENSEMBL: ENSMUSP00000149214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035101] [ENSMUST00000177637] [ENSMUST00000213936] [ENSMUST00000214058] [ENSMUST00000215916] [ENSMUST00000216929]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035101
AA Change: Q200E

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035101
Gene: ENSMUSG00000032515
AA Change: Q200E

DomainStartEndE-ValueType
low complexity region 17 41 N/A INTRINSIC
Pfam:CSRNP_N 79 304 1.6e-93 PFAM
low complexity region 327 361 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 463 482 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213936
Predicted Effect possibly damaging
Transcript: ENSMUST00000214058
AA Change: Q200E

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215916
AA Change: Q200E

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000216929
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to the nucleus and expression of this gene is induced in response to elevated levels of axin. The Wnt signalling pathway, which is negatively regulated by axin, is important in axis formation in early development and impaired regulation of this signalling pathway is often involved in tumors. A decreased level of expression of this gene in tumors compared to the level of expression in their corresponding normal tissues suggests that this gene product has a tumor suppressor function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality and skeletal and craniofacial defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,569,378 C425R probably damaging Het
Adam15 A G 3: 89,349,830 S20P probably damaging Het
Adgra3 G A 5: 49,961,137 T1023I probably benign Het
Angel2 T A 1: 190,939,088 V46E probably damaging Het
Ankrd13c T A 3: 157,991,721 M321K probably damaging Het
Atad2b C T 12: 4,942,018 R206* probably null Het
Atp10b T A 11: 43,197,524 F319Y probably benign Het
AW554918 A G 18: 25,400,104 R272G probably damaging Het
BC027072 A G 17: 71,749,478 V1068A probably benign Het
Bpi T A 2: 158,261,145 I70N probably damaging Het
Brca1 T C 11: 101,524,695 D871G probably damaging Het
Capn3 G A 2: 120,482,208 A160T probably damaging Het
Cenpe T C 3: 135,246,902 L1451P possibly damaging Het
Chmp7 A G 14: 69,732,488 M1T probably null Het
Dscam G A 16: 96,819,874 P545S probably damaging Het
Erap1 A G 13: 74,646,543 E107G probably benign Het
Errfi1 A G 4: 150,865,386 I49V probably benign Het
Fam160b1 T A 19: 57,386,305 I704N probably damaging Het
Fam171b T C 2: 83,880,189 L735S probably damaging Het
Fancm T A 12: 65,092,490 probably null Het
Fbp2 G C 13: 62,837,159 P316R probably damaging Het
Fcer2a C A 8: 3,682,976 G255V probably damaging Het
Fzd2 T C 11: 102,605,308 S193P probably benign Het
Gak A G 5: 108,624,193 V86A probably damaging Het
Gas2l3 A G 10: 89,433,769 I7T probably benign Het
Gbp11 T C 5: 105,327,489 H331R probably damaging Het
Gpr19 C T 6: 134,869,998 V241M probably damaging Het
Grk6 G A 13: 55,458,799 A437T probably damaging Het
Hip1 T C 5: 135,444,780 D253G probably damaging Het
Ifna9 G C 4: 88,592,172 Q72E possibly damaging Het
Il1r1 A G 1: 40,312,361 T384A probably benign Het
Ip6k1 C A 9: 108,045,562 C221* probably null Het
Kcna1 C A 6: 126,642,531 E275D probably benign Het
Kcnt2 C T 1: 140,484,232 Q468* probably null Het
Kin T C 2: 10,092,339 V333A probably damaging Het
Leprot G T 4: 101,656,287 V91L probably benign Het
Mettl21c A G 1: 44,017,184 probably null Het
Myom2 T C 8: 15,122,384 F1161S probably damaging Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nipal2 A T 15: 34,625,022 *72K probably null Het
Nol3 T C 8: 105,279,226 V84A probably benign Het
Olfr1188 A T 2: 88,559,483 I5F probably benign Het
Olfr1388 C T 11: 49,443,905 S18L probably benign Het
Olfr901 T C 9: 38,430,324 I14T probably damaging Het
Pdgfra T A 5: 75,189,010 probably null Het
Pik3cb T C 9: 99,053,973 D802G probably damaging Het
Plac8l1 A T 18: 42,178,931 V141E probably damaging Het
Plxnb2 A G 15: 89,167,192 S275P probably benign Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rapgef6 T A 11: 54,661,183 I959K probably damaging Het
Scn5a T C 9: 119,495,562 K1400R probably damaging Het
Sel1l A G 12: 91,826,684 S263P probably damaging Het
Setd5 G A 6: 113,109,913 V34I probably damaging Het
Slc17a2 A G 13: 23,819,069 D234G probably damaging Het
Spink5 T A 18: 44,015,671 S934T probably damaging Het
St18 A C 1: 6,845,569 probably null Het
St3gal4 T C 9: 35,052,296 I239V probably benign Het
Stag3 C T 5: 138,297,412 T399I probably damaging Het
Syt11 T C 3: 88,762,367 K6E probably damaging Het
Taf15 T C 11: 83,487,296 Y121H possibly damaging Het
Tdh T C 14: 63,496,055 Y113C probably damaging Het
Tgfbr1 T A 4: 47,410,688 W406R probably damaging Het
Tgm6 A G 2: 130,151,282 I563V possibly damaging Het
Tmem131 A G 1: 36,827,009 probably null Het
Tmub2 T C 11: 102,287,486 S72P probably benign Het
Trappc13 G A 13: 104,150,143 T202I probably damaging Het
Trim9 T C 12: 70,272,428 E449G probably damaging Het
Trip11 C A 12: 101,912,767 G21V unknown Het
Ttll12 G A 15: 83,588,655 R127C probably damaging Het
Vmn2r125 A T 4: 156,351,152 Y275F probably damaging Het
Xrcc5 A G 1: 72,329,944 D319G probably damaging Het
Zc3h14 T G 12: 98,785,003 C159W probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfhx3 C T 8: 108,948,489 P2057L probably damaging Het
Other mutations in Csrnp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Csrnp1 APN 9 119972958 missense probably damaging 1.00
IGL02348:Csrnp1 APN 9 119972643 missense probably damaging 1.00
R0463:Csrnp1 UTSW 9 119972775 unclassified probably benign
R3901:Csrnp1 UTSW 9 119972641 missense probably damaging 1.00
R5851:Csrnp1 UTSW 9 119973078 missense possibly damaging 0.93
R6101:Csrnp1 UTSW 9 119973485 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCACGCACCTGGCACTTAATG -3'
(R):5'- TAGCTGTGGAGCACAGTGTGTACC -3'

Sequencing Primer
(F):5'- AGACGCCATCACAGTGACAA -3'
(R):5'- CACTCTCTGGGAGAGCTAAATC -3'
Posted On2014-04-13