Incidental Mutation 'R1530:Fam160b1'
ID166599
Institutional Source Beutler Lab
Gene Symbol Fam160b1
Ensembl Gene ENSMUSG00000033478
Gene Namefamily with sequence similarity 160, member B1
Synonyms
MMRRC Submission 039569-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R1530 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location57361009-57389594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57386305 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 704 (I704N)
Ref Sequence ENSEMBL: ENSMUSP00000048903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036407]
Predicted Effect probably damaging
Transcript: ENSMUST00000036407
AA Change: I704N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048903
Gene: ENSMUSG00000033478
AA Change: I704N

DomainStartEndE-ValueType
Pfam:RAI16-like 78 495 1.1e-144 PFAM
low complexity region 713 724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,569,378 C425R probably damaging Het
Adam15 A G 3: 89,349,830 S20P probably damaging Het
Adgra3 G A 5: 49,961,137 T1023I probably benign Het
Angel2 T A 1: 190,939,088 V46E probably damaging Het
Ankrd13c T A 3: 157,991,721 M321K probably damaging Het
Atad2b C T 12: 4,942,018 R206* probably null Het
Atp10b T A 11: 43,197,524 F319Y probably benign Het
AW554918 A G 18: 25,400,104 R272G probably damaging Het
BC027072 A G 17: 71,749,478 V1068A probably benign Het
Bpi T A 2: 158,261,145 I70N probably damaging Het
Brca1 T C 11: 101,524,695 D871G probably damaging Het
Capn3 G A 2: 120,482,208 A160T probably damaging Het
Cenpe T C 3: 135,246,902 L1451P possibly damaging Het
Chmp7 A G 14: 69,732,488 M1T probably null Het
Csrnp1 G C 9: 119,973,546 Q200E possibly damaging Het
Dscam G A 16: 96,819,874 P545S probably damaging Het
Erap1 A G 13: 74,646,543 E107G probably benign Het
Errfi1 A G 4: 150,865,386 I49V probably benign Het
Fam171b T C 2: 83,880,189 L735S probably damaging Het
Fancm T A 12: 65,092,490 probably null Het
Fbp2 G C 13: 62,837,159 P316R probably damaging Het
Fcer2a C A 8: 3,682,976 G255V probably damaging Het
Fzd2 T C 11: 102,605,308 S193P probably benign Het
Gak A G 5: 108,624,193 V86A probably damaging Het
Gas2l3 A G 10: 89,433,769 I7T probably benign Het
Gbp11 T C 5: 105,327,489 H331R probably damaging Het
Gpr19 C T 6: 134,869,998 V241M probably damaging Het
Grk6 G A 13: 55,458,799 A437T probably damaging Het
Hip1 T C 5: 135,444,780 D253G probably damaging Het
Ifna9 G C 4: 88,592,172 Q72E possibly damaging Het
Il1r1 A G 1: 40,312,361 T384A probably benign Het
Ip6k1 C A 9: 108,045,562 C221* probably null Het
Kcna1 C A 6: 126,642,531 E275D probably benign Het
Kcnt2 C T 1: 140,484,232 Q468* probably null Het
Kin T C 2: 10,092,339 V333A probably damaging Het
Leprot G T 4: 101,656,287 V91L probably benign Het
Mettl21c A G 1: 44,017,184 probably null Het
Myom2 T C 8: 15,122,384 F1161S probably damaging Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nipal2 A T 15: 34,625,022 *72K probably null Het
Nol3 T C 8: 105,279,226 V84A probably benign Het
Olfr1188 A T 2: 88,559,483 I5F probably benign Het
Olfr1388 C T 11: 49,443,905 S18L probably benign Het
Olfr901 T C 9: 38,430,324 I14T probably damaging Het
Pdgfra T A 5: 75,189,010 probably null Het
Pik3cb T C 9: 99,053,973 D802G probably damaging Het
Plac8l1 A T 18: 42,178,931 V141E probably damaging Het
Plxnb2 A G 15: 89,167,192 S275P probably benign Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rapgef6 T A 11: 54,661,183 I959K probably damaging Het
Scn5a T C 9: 119,495,562 K1400R probably damaging Het
Sel1l A G 12: 91,826,684 S263P probably damaging Het
Setd5 G A 6: 113,109,913 V34I probably damaging Het
Slc17a2 A G 13: 23,819,069 D234G probably damaging Het
Spink5 T A 18: 44,015,671 S934T probably damaging Het
St18 A C 1: 6,845,569 probably null Het
St3gal4 T C 9: 35,052,296 I239V probably benign Het
Stag3 C T 5: 138,297,412 T399I probably damaging Het
Syt11 T C 3: 88,762,367 K6E probably damaging Het
Taf15 T C 11: 83,487,296 Y121H possibly damaging Het
Tdh T C 14: 63,496,055 Y113C probably damaging Het
Tgfbr1 T A 4: 47,410,688 W406R probably damaging Het
Tgm6 A G 2: 130,151,282 I563V possibly damaging Het
Tmem131 A G 1: 36,827,009 probably null Het
Tmub2 T C 11: 102,287,486 S72P probably benign Het
Trappc13 G A 13: 104,150,143 T202I probably damaging Het
Trim9 T C 12: 70,272,428 E449G probably damaging Het
Trip11 C A 12: 101,912,767 G21V unknown Het
Ttll12 G A 15: 83,588,655 R127C probably damaging Het
Vmn2r125 A T 4: 156,351,152 Y275F probably damaging Het
Xrcc5 A G 1: 72,329,944 D319G probably damaging Het
Zc3h14 T G 12: 98,785,003 C159W probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfhx3 C T 8: 108,948,489 P2057L probably damaging Het
Other mutations in Fam160b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fam160b1 APN 19 57381345 missense probably benign 0.00
IGL02642:Fam160b1 APN 19 57385350 missense possibly damaging 0.55
IGL03152:Fam160b1 APN 19 57378832 missense probably damaging 0.99
fredericksburg UTSW 19 57384123 nonsense probably null
R0001:Fam160b1 UTSW 19 57381756 missense probably benign 0.01
R0123:Fam160b1 UTSW 19 57381407 missense probably benign 0.00
R0368:Fam160b1 UTSW 19 57368578 missense possibly damaging 0.91
R0446:Fam160b1 UTSW 19 57381407 missense probably benign 0.00
R0508:Fam160b1 UTSW 19 57378742 missense probably benign 0.04
R0926:Fam160b1 UTSW 19 57381090 missense probably damaging 1.00
R1122:Fam160b1 UTSW 19 57382301 missense probably benign 0.00
R1344:Fam160b1 UTSW 19 57371162 missense possibly damaging 0.72
R1398:Fam160b1 UTSW 19 57372926 splice site probably benign
R1418:Fam160b1 UTSW 19 57371162 missense possibly damaging 0.72
R1506:Fam160b1 UTSW 19 57368575 missense probably benign 0.30
R1695:Fam160b1 UTSW 19 57379171 missense probably damaging 1.00
R1868:Fam160b1 UTSW 19 57386305 missense possibly damaging 0.75
R1974:Fam160b1 UTSW 19 57385377 missense probably damaging 0.99
R2004:Fam160b1 UTSW 19 57381892 missense probably benign
R2893:Fam160b1 UTSW 19 57384169 missense probably benign 0.01
R3011:Fam160b1 UTSW 19 57385288 missense probably damaging 1.00
R3963:Fam160b1 UTSW 19 57373010 missense possibly damaging 0.77
R4416:Fam160b1 UTSW 19 57385397 splice site probably null
R4613:Fam160b1 UTSW 19 57371187 missense probably damaging 0.99
R4735:Fam160b1 UTSW 19 57371229 missense probably damaging 1.00
R4893:Fam160b1 UTSW 19 57381756 missense probably benign 0.01
R4937:Fam160b1 UTSW 19 57378637 missense probably benign
R5049:Fam160b1 UTSW 19 57386305 missense possibly damaging 0.75
R5050:Fam160b1 UTSW 19 57383170 missense probably damaging 1.00
R5080:Fam160b1 UTSW 19 57373281 missense probably damaging 1.00
R5176:Fam160b1 UTSW 19 57371181 missense probably damaging 0.98
R5317:Fam160b1 UTSW 19 57381709 splice site probably null
R5347:Fam160b1 UTSW 19 57378619 missense probably benign
R5497:Fam160b1 UTSW 19 57381151 splice site probably null
R5969:Fam160b1 UTSW 19 57384123 nonsense probably null
R6418:Fam160b1 UTSW 19 57381734 missense probably benign 0.18
R6426:Fam160b1 UTSW 19 57383178 missense probably damaging 1.00
R6765:Fam160b1 UTSW 19 57378745 missense probably benign
X0023:Fam160b1 UTSW 19 57384147 nonsense probably null
X0062:Fam160b1 UTSW 19 57385257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAAAACACGGGCCACGGG -3'
(R):5'- GACAGAAAATCAGAATAGCAGTGCAACC -3'

Sequencing Primer
(F):5'- tgacacagcaagcccag -3'
(R):5'- ATAGCAGTGCAACCCTGAG -3'
Posted On2014-04-13