Incidental Mutation 'W0251:Olfr155'
ID166600
Institutional Source Beutler Lab
Gene Symbol Olfr155
Ensembl Gene ENSMUSG00000071000
Gene Nameolfactory receptor 155
SynonymsOR37A, Olfr37a, GA_x6K02T2N78B-16092200-16091241, mOR37a, MOR262-14
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #W0251 (G3R) of strain daniel_gray
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43851565-43857595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43855058 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 250 (L250F)
Ref Sequence ENSEMBL: ENSMUSP00000103492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095108] [ENSMUST00000107860]
Predicted Effect probably benign
Transcript: ENSMUST00000095108
AA Change: L250F

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092726
Gene: ENSMUSG00000071000
AA Change: L250F

DomainStartEndE-ValueType
Pfam:7tm_1 42 297 2.8e-35 PFAM
Pfam:7tm_4 140 290 1.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107860
AA Change: L250F

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103492
Gene: ENSMUSG00000071000
AA Change: L250F

DomainStartEndE-ValueType
Pfam:7tm_4 32 315 9.7e-59 PFAM
Pfam:7tm_1 42 297 3.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl2a1b T A 9: 89,199,583 M75K probably damaging Het
Btaf1 G A 19: 37,003,504 R1575H probably damaging Het
Cfap46 T C 7: 139,603,946 M2507V probably benign Het
Dcc T C 18: 71,826,083 D206G probably damaging Het
Dnah6 T A 6: 73,178,518 I705F possibly damaging Het
Entpd1 A T 19: 40,726,253 I269F probably damaging Het
Gm4559 G C 7: 142,273,798 A189G unknown Het
Ipo5 T A 14: 120,938,785 M648K probably benign Het
Kdelr1 A G 7: 45,881,621 Y96C probably damaging Het
Mmp17 C T 5: 129,595,527 A181V probably benign Het
Muc20 T C 16: 32,793,853 I385V possibly damaging Het
Pik3r6 A G 11: 68,533,871 Y434C probably benign Het
Pura T C 18: 36,287,790 V210A probably benign Het
Spic C T 10: 88,679,904 D19N probably damaging Het
Other mutations in Olfr155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02729:Olfr155 APN 4 43854439 missense probably damaging 1.00
R0240:Olfr155 UTSW 4 43854512 missense probably damaging 1.00
R0240:Olfr155 UTSW 4 43854512 missense probably damaging 1.00
R0285:Olfr155 UTSW 4 43854398 missense possibly damaging 0.46
R0427:Olfr155 UTSW 4 43854417 missense probably damaging 1.00
R4468:Olfr155 UTSW 4 43854737 missense probably benign 0.08
R4548:Olfr155 UTSW 4 43854834 missense probably damaging 1.00
R4583:Olfr155 UTSW 4 43855262 missense probably benign
R4793:Olfr155 UTSW 4 43854323 missense probably benign 0.37
R4884:Olfr155 UTSW 4 43854890 missense probably damaging 1.00
R5016:Olfr155 UTSW 4 43854596 missense probably benign 0.02
R5220:Olfr155 UTSW 4 43854624 missense possibly damaging 0.89
R5613:Olfr155 UTSW 4 43854528 missense probably damaging 0.99
R5805:Olfr155 UTSW 4 43855152 missense probably benign 0.15
R5955:Olfr155 UTSW 4 43854898 missense probably damaging 1.00
R6250:Olfr155 UTSW 4 43854363 missense possibly damaging 0.58
R6768:Olfr155 UTSW 4 43854351 missense probably benign 0.01
R6801:Olfr155 UTSW 4 43855206 nonsense probably null
R6835:Olfr155 UTSW 4 43854912 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGAGATCCTGGCAGTCCTGAAAC -3'
(R):5'- AACCAGCCATTCTCTCCAAAGGTG -3'

Sequencing Primer
(F):5'- AGTCCTGAAACTGGCCTGTG -3'
(R):5'- accactcttccctcacaaac -3'
Posted On2014-04-13