Mutagenetix > Incidental Mutation

Incidental Mutation 'W0251:Muc20'

166613

Institutional Source

Beutler Lab

Gene Symbol

Muc20

Ensembl Gene

ENSMUSG00000035638

Gene Name

mucin 20

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

W0251 (G3R) of strain daniel_gray

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

32597793-32617805 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32614223 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 385 (I385V)

Ref Sequence

ENSEMBL: ENSMUSP00000110769 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041123] [ENSMUST00000115116]

AlphaFold

Q8BUE7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041123
AA Change: I385V

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000041221
Gene: ENSMUSG00000035638
AA Change: I385V

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
internal_repeat_1	114	146	3.3e-8	PROSPERO
internal_repeat_1	138	170	3.3e-8	PROSPERO
internal_repeat_2	144	161	5.26e-5	PROSPERO
low complexity region	171	204	N/A	INTRINSIC
low complexity region	210	227	N/A	INTRINSIC
internal_repeat_2	228	245	5.26e-5	PROSPERO
low complexity region	324	351	N/A	INTRINSIC
low complexity region	376	385	N/A	INTRINSIC
low complexity region	516	550	N/A	INTRINSIC
low complexity region	574	593	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115116
AA Change: I385V

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110769
Gene: ENSMUSG00000035638
AA Change: I385V

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
internal_repeat_1	114	146	2.16e-8	PROSPERO
internal_repeat_1	138	170	2.16e-8	PROSPERO
internal_repeat_2	144	161	4e-5	PROSPERO
low complexity region	171	204	N/A	INTRINSIC
low complexity region	210	227	N/A	INTRINSIC
internal_repeat_2	228	245	4e-5	PROSPERO
low complexity region	324	351	N/A	INTRINSIC
low complexity region	376	385	N/A	INTRINSIC
low complexity region	516	550	N/A	INTRINSIC
low complexity region	574	593	N/A	INTRINSIC
low complexity region	662	679	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins secreted by many epithelial tissues to form an insoluble mucous barrier. The C-terminus of this family member associates with the multifunctional docking site of the MET proto-oncogene and suppresses activation of some downstream MET signaling cascades. The protein features a mucin tandem repeat domain that varies between two and six copies in most individuals. Multiple variants encoding different isoforms have been found for this gene. A related pseudogene, which is also located on chromosome 3, has been identified. [provided by RefSeq, Apr 2014]

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcl2a1b	T	A	9: 89,081,636 (GRCm39)	M75K	probably damaging	Het
Btaf1	G	A	19: 36,980,904 (GRCm39)	R1575H	probably damaging	Het
Cfap46	T	C	7: 139,183,862 (GRCm39)	M2507V	probably benign	Het
Dcc	T	C	18: 71,959,154 (GRCm39)	D206G	probably damaging	Het
Dnah6	T	A	6: 73,155,501 (GRCm39)	I705F	possibly damaging	Het
Entpd1	A	T	19: 40,714,697 (GRCm39)	I269F	probably damaging	Het
Gm4559	G	C	7: 141,827,535 (GRCm39)	A189G	unknown	Het
Ipo5	T	A	14: 121,176,197 (GRCm39)	M648K	probably benign	Het
Kdelr1	A	G	7: 45,531,045 (GRCm39)	Y96C	probably damaging	Het
Mmp17	C	T	5: 129,672,591 (GRCm39)	A181V	probably benign	Het
Or13c7	C	T	4: 43,855,058 (GRCm39)	L250F	probably benign	Het
Pik3r6	A	G	11: 68,424,697 (GRCm39)	Y434C	probably benign	Het
Pura	T	C	18: 36,420,843 (GRCm39)	V210A	probably benign	Het
Spic	C	T	10: 88,515,766 (GRCm39)	D19N	probably damaging	Het

Other mutations in Muc20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01953:Muc20	APN	16	32,614,073 (GRCm39)	missense	probably benign	0.10
IGL02016:Muc20	APN	16	32,617,722 (GRCm39)	missense	possibly damaging	0.46
IGL02092:Muc20	APN	16	32,614,642 (GRCm39)	missense	probably damaging	0.99
IGL02415:Muc20	APN	16	32,615,051 (GRCm39)	missense	unknown
R6669_muc20_072	UTSW	16	32,614,307 (GRCm39)	missense	possibly damaging	0.94
R0552:Muc20	UTSW	16	32,614,300 (GRCm39)	missense	probably damaging	0.98
R0629:Muc20	UTSW	16	32,613,791 (GRCm39)	missense	possibly damaging	0.66
R0669:Muc20	UTSW	16	32,614,850 (GRCm39)	missense	unknown
R0725:Muc20	UTSW	16	32,613,858 (GRCm39)	missense	probably benign	0.05
R1676:Muc20	UTSW	16	32,614,649 (GRCm39)	missense	probably damaging	1.00
R1771:Muc20	UTSW	16	32,614,222 (GRCm39)	missense	probably damaging	0.97
R1778:Muc20	UTSW	16	32,614,511 (GRCm39)	missense	possibly damaging	0.49
R1967:Muc20	UTSW	16	32,614,612 (GRCm39)	missense	probably benign	0.03
R2104:Muc20	UTSW	16	32,614,547 (GRCm39)	missense	probably damaging	0.99
R3054:Muc20	UTSW	16	32,599,403 (GRCm39)	missense	probably benign	0.18
R4704:Muc20	UTSW	16	32,599,448 (GRCm39)	missense	possibly damaging	0.70
R4893:Muc20	UTSW	16	32,615,042 (GRCm39)	missense	possibly damaging	0.66
R4986:Muc20	UTSW	16	32,598,009 (GRCm39)	intron	probably benign
R5191:Muc20	UTSW	16	32,614,846 (GRCm39)	missense	unknown
R5195:Muc20	UTSW	16	32,614,846 (GRCm39)	missense	unknown
R5875:Muc20	UTSW	16	32,614,189 (GRCm39)	missense	possibly damaging	0.93
R5931:Muc20	UTSW	16	32,614,944 (GRCm39)	missense	possibly damaging	0.81
R6434:Muc20	UTSW	16	32,615,176 (GRCm39)	missense	probably benign	0.01
R6523:Muc20	UTSW	16	32,613,820 (GRCm39)	missense	possibly damaging	0.90
R6580:Muc20	UTSW	16	32,613,859 (GRCm39)	missense	possibly damaging	0.77
R6669:Muc20	UTSW	16	32,614,307 (GRCm39)	missense	possibly damaging	0.94
R7028:Muc20	UTSW	16	32,614,616 (GRCm39)	missense	probably benign	0.03
R7681:Muc20	UTSW	16	32,613,989 (GRCm39)	missense	probably benign	0.34
R7722:Muc20	UTSW	16	32,617,756 (GRCm39)	missense	probably benign	0.00
R8678:Muc20	UTSW	16	32,617,789 (GRCm39)	start gained	probably benign
R8730:Muc20	UTSW	16	32,599,490 (GRCm39)	missense	probably benign	0.03
R8838:Muc20	UTSW	16	32,613,829 (GRCm39)	missense	possibly damaging	0.64
R9017:Muc20	UTSW	16	32,614,840 (GRCm39)	missense	unknown
R9230:Muc20	UTSW	16	32,613,584 (GRCm39)	missense	probably damaging	1.00
R9368:Muc20	UTSW	16	32,614,471 (GRCm39)	missense	possibly damaging	0.69
R9474:Muc20	UTSW	16	32,614,453 (GRCm39)	missense	probably damaging	1.00
R9486:Muc20	UTSW	16	32,615,248 (GRCm39)	missense	possibly damaging	0.92
R9603:Muc20	UTSW	16	32,615,155 (GRCm39)	missense	probably damaging	0.97
R9710:Muc20	UTSW	16	32,615,266 (GRCm39)	missense	possibly damaging	0.92
X0011:Muc20	UTSW	16	32,613,622 (GRCm39)	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- AACTGTCACCGAAGTTCCAACAGAG -3'
(R):5'- TGAGCACTGTCCAAACTGGCAC -3'

Sequencing Primer
(F):5'- TAGTGGAGACTGTCCCCTCAAG -3'
(R):5'- TTGTACCGATGACAGCTCTGAAG -3'

Posted On

2014-04-13