Incidental Mutation 'R1532:Reln'
ID166639
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Namereelin
Synonyms
MMRRC Submission 039571-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R1532 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21884454-22344702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 22034744 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 842 (W842G)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
Predicted Effect probably damaging
Transcript: ENSMUST00000062372
AA Change: W842G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: W842G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161356
AA Change: W842G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: W842G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162427
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 C A 4: 86,248,065 H394N probably benign Het
Ahrr A G 13: 74,213,707 S558P probably benign Het
Ankrd26 T C 6: 118,522,958 N1184S probably damaging Het
Anpep A T 7: 79,826,948 C14* probably null Het
Arhgap18 A G 10: 26,860,722 D187G possibly damaging Het
Arhgef5 A G 6: 43,273,403 T363A probably benign Het
Atxn1 A T 13: 45,566,910 L503Q possibly damaging Het
Babam1 A G 8: 71,399,633 D155G possibly damaging Het
Bbs9 A G 9: 22,887,649 T858A probably benign Het
Cacna1g C A 11: 94,443,331 G828V probably damaging Het
Ccar2 T C 14: 70,142,956 T392A probably benign Het
Cd163 T C 6: 124,312,730 V469A possibly damaging Het
Cdh23 G T 10: 60,314,331 N2576K probably damaging Het
Coro2b A G 9: 62,489,423 Y18H probably damaging Het
Crispld2 G T 8: 120,023,572 K238N probably benign Het
Ctnnd2 T C 15: 30,921,868 I880T probably damaging Het
Cubn C A 2: 13,287,661 C3237F probably damaging Het
Ddx31 A G 2: 28,881,159 M519V probably benign Het
Dhx32 A T 7: 133,749,024 C106S possibly damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dnaaf1 T C 8: 119,577,423 F67L probably benign Het
Duox1 T G 2: 122,344,723 L1334R probably damaging Het
Dync1li2 A T 8: 104,426,035 I322N probably damaging Het
Eml6 T C 11: 29,792,256 probably null Het
Entpd6 A G 2: 150,758,750 Q126R probably benign Het
Entpd7 C G 19: 43,691,077 P23R possibly damaging Het
Epha3 T C 16: 63,546,178 I970V probably benign Het
Fras1 A T 5: 96,713,996 H2163L probably damaging Het
Gse1 C G 8: 120,568,210 probably benign Het
Heatr5a A G 12: 51,952,518 V300A probably damaging Het
Hsd3b1 T A 3: 98,852,898 D259V probably damaging Het
Hspbap1 T C 16: 35,825,303 S453P probably damaging Het
Ifnl3 A G 7: 28,524,227 T163A probably benign Het
Igbp1b T A 6: 138,658,444 M1L possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lpxn T C 19: 12,804,092 probably null Het
Mast1 G A 8: 84,928,609 Q249* probably null Het
Mink1 A G 11: 70,602,007 D153G probably null Het
Mllt10 G A 2: 18,092,835 probably null Het
Mpl C T 4: 118,448,568 G420E possibly damaging Het
Ms4a1 T A 19: 11,253,193 T215S probably benign Het
Ncapd3 C T 9: 27,083,360 Q1179* probably null Het
Nr3c2 A G 8: 76,909,104 H278R probably damaging Het
Olfr1417 T C 19: 11,828,619 I136V probably benign Het
Olfr1454 A G 19: 13,064,275 Y288C probably damaging Het
Olfr670 T C 7: 104,960,265 I156V probably benign Het
Os9 C T 10: 127,098,902 V353M probably damaging Het
Osbpl5 A T 7: 143,695,080 M589K probably benign Het
Phf20 G T 2: 156,303,049 G859V possibly damaging Het
Pkhd1 G A 1: 20,117,401 T3561I probably benign Het
Prss46 G A 9: 110,850,168 V146I probably benign Het
Ptprk G A 10: 28,585,630 V1139M probably damaging Het
Ranbp10 A G 8: 105,774,331 L396P probably benign Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Rbl2 G A 8: 91,106,417 A659T probably benign Het
Rdm1 T C 11: 101,633,817 L192P probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sele A G 1: 164,053,851 K509R probably benign Het
Slc15a1 A T 14: 121,475,984 I377N possibly damaging Het
Slc17a3 G A 13: 23,856,500 G269D probably damaging Het
Slc35a5 T C 16: 45,151,557 T115A probably benign Het
Slc5a12 T G 2: 110,610,138 N157K possibly damaging Het
Sphkap A G 1: 83,257,203 V1634A probably damaging Het
Spta1 T C 1: 174,247,353 S2382P probably damaging Het
Synj2 C A 17: 6,033,919 S1100R probably benign Het
Tcf23 A G 5: 30,973,557 T180A probably benign Het
Tnxb T C 17: 34,710,830 V2846A probably damaging Het
Tpr T A 1: 150,418,000 I915K probably damaging Het
Uba1y C T Y: 828,862 H557Y probably benign Het
Unc45b T A 11: 82,936,874 D730E probably benign Het
Unc5b A T 10: 60,769,232 L734Q probably damaging Het
Vmn1r167 G T 7: 23,504,779 H271N probably benign Het
Vmn2r76 A G 7: 86,230,246 V282A probably benign Het
Xirp2 A G 2: 67,513,939 K2175E probably benign Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00091:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00432:Reln APN 5 22010127 missense probably damaging 1.00
IGL00433:Reln APN 5 22045009 missense probably damaging 1.00
IGL00576:Reln APN 5 22154950 missense probably benign 0.01
IGL00755:Reln APN 5 22060380 missense probably damaging 0.98
IGL00777:Reln APN 5 22018850 critical splice donor site probably null
IGL00900:Reln APN 5 21980117 missense probably damaging 0.98
IGL01067:Reln APN 5 21979666 missense probably damaging 1.00
IGL01104:Reln APN 5 21986967 missense probably damaging 0.99
IGL01141:Reln APN 5 21969033 missense probably damaging 1.00
IGL01141:Reln APN 5 21919069 missense probably damaging 1.00
IGL01333:Reln APN 5 22171251 missense probably damaging 0.99
IGL01341:Reln APN 5 21969079 missense probably damaging 1.00
IGL01354:Reln APN 5 21919175 nonsense probably null
IGL01361:Reln APN 5 21919021 missense probably benign 0.06
IGL01446:Reln APN 5 21969317 missense probably damaging 0.99
IGL01448:Reln APN 5 22040405 missense probably benign 0.40
IGL01612:Reln APN 5 21896930 missense probably damaging 0.99
IGL01695:Reln APN 5 21920438 missense probably damaging 1.00
IGL01718:Reln APN 5 21947514 missense possibly damaging 0.60
IGL01749:Reln APN 5 22344246 nonsense probably null
IGL01875:Reln APN 5 21904717 missense probably benign
IGL02013:Reln APN 5 21950879 missense probably damaging 1.00
IGL02031:Reln APN 5 21979016 missense probably damaging 0.99
IGL02186:Reln APN 5 21909958 missense probably damaging 1.00
IGL02228:Reln APN 5 21904731 missense probably damaging 0.99
IGL02248:Reln APN 5 21910992 missense probably damaging 1.00
IGL02336:Reln APN 5 21929134 missense probably damaging 1.00
IGL02352:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02359:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02376:Reln APN 5 22080791 nonsense probably null
IGL02408:Reln APN 5 21901619 missense probably benign 0.44
IGL02415:Reln APN 5 21971951 missense possibly damaging 0.91
IGL02512:Reln APN 5 22040427 missense probably benign 0.00
IGL02540:Reln APN 5 22034752 missense probably damaging 0.96
IGL02624:Reln APN 5 22103357 missense probably benign 0.09
IGL02720:Reln APN 5 21997941 missense probably damaging 0.99
IGL02894:Reln APN 5 21885548 missense possibly damaging 0.72
IGL02999:Reln APN 5 21995365 missense probably damaging 1.00
IGL03125:Reln APN 5 21910844 missense probably damaging 1.00
IGL03298:Reln APN 5 21910836 missense probably damaging 0.99
fishing UTSW 5 21896841 missense probably damaging 1.00
P0020:Reln UTSW 5 22106060 missense possibly damaging 0.91
R0018:Reln UTSW 5 21925371 missense probably benign 0.01
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0127:Reln UTSW 5 22004136 missense probably damaging 1.00
R0135:Reln UTSW 5 22128649 missense probably damaging 0.99
R0144:Reln UTSW 5 21948449 missense probably damaging 0.97
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0266:Reln UTSW 5 21988776 missense probably damaging 1.00
R0269:Reln UTSW 5 21920537 missense probably damaging 1.00
R0280:Reln UTSW 5 22227513 splice site probably benign
R0333:Reln UTSW 5 21929242 missense probably damaging 0.97
R0357:Reln UTSW 5 21950822 missense probably damaging 1.00
R0359:Reln UTSW 5 22048800 missense probably damaging 0.98
R0506:Reln UTSW 5 21920496 missense probably damaging 0.97
R0534:Reln UTSW 5 21947408 missense probably damaging 0.99
R0535:Reln UTSW 5 22051276 splice site probably benign
R0541:Reln UTSW 5 21980109 missense possibly damaging 0.88
R0615:Reln UTSW 5 22010150 missense probably benign 0.36
R0617:Reln UTSW 5 21920537 missense probably damaging 1.00
R0634:Reln UTSW 5 22018869 missense probably damaging 1.00
R0653:Reln UTSW 5 21913230 missense probably benign 0.44
R0704:Reln UTSW 5 21896811 missense probably damaging 0.99
R0706:Reln UTSW 5 21896811 missense probably damaging 0.99
R0959:Reln UTSW 5 22227628 missense probably damaging 0.96
R1066:Reln UTSW 5 22034664 missense probably damaging 1.00
R1110:Reln UTSW 5 22034775 missense probably benign
R1163:Reln UTSW 5 21899029 missense probably benign 0.03
R1222:Reln UTSW 5 21986955 missense probably null 0.97
R1226:Reln UTSW 5 21910866 missense probably damaging 1.00
R1440:Reln UTSW 5 22128602 splice site probably benign
R1552:Reln UTSW 5 21960378 missense probably benign 0.01
R1565:Reln UTSW 5 21925213 missense probably benign 0.05
R1618:Reln UTSW 5 22060368 missense probably benign 0.01
R1636:Reln UTSW 5 21998683 missense probably damaging 0.99
R1664:Reln UTSW 5 21929086 missense probably damaging 1.00
R1716:Reln UTSW 5 21955095 missense probably damaging 0.98
R1759:Reln UTSW 5 22010289 missense probably damaging 0.99
R1835:Reln UTSW 5 21979002 missense probably damaging 1.00
R1907:Reln UTSW 5 22044962 critical splice donor site probably null
R1991:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2046:Reln UTSW 5 21942627 missense probably benign 0.01
R2072:Reln UTSW 5 21919177 missense probably damaging 1.00
R2103:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2119:Reln UTSW 5 22019000 missense probably damaging 1.00
R2120:Reln UTSW 5 21969085 missense probably damaging 1.00
R2216:Reln UTSW 5 22048005 missense probably benign 0.30
R2219:Reln UTSW 5 21972047 missense possibly damaging 0.88
R2228:Reln UTSW 5 21987078 missense possibly damaging 0.69
R2306:Reln UTSW 5 21896786 missense probably damaging 1.00
R2316:Reln UTSW 5 22154956 missense probably benign 0.00
R2321:Reln UTSW 5 21915020 missense probably damaging 0.99
R2512:Reln UTSW 5 21979690 missense possibly damaging 0.89
R2519:Reln UTSW 5 22344369 missense unknown
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R3195:Reln UTSW 5 22040420 missense possibly damaging 0.72
R3545:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3546:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3547:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3706:Reln UTSW 5 21995589 splice site probably benign
R3713:Reln UTSW 5 21904734 missense probably damaging 0.99
R3770:Reln UTSW 5 21948566 missense probably damaging 1.00
R3836:Reln UTSW 5 21911014 missense probably damaging 1.00
R3887:Reln UTSW 5 21910849 missense possibly damaging 0.92
R3972:Reln UTSW 5 21979001 missense probably damaging 0.99
R3975:Reln UTSW 5 21995366 missense possibly damaging 0.57
R4022:Reln UTSW 5 22227630 missense probably benign 0.45
R4044:Reln UTSW 5 22128632 missense possibly damaging 0.82
R4107:Reln UTSW 5 22034584 missense probably damaging 1.00
R4297:Reln UTSW 5 21920487 missense probably damaging 0.99
R4298:Reln UTSW 5 21920487 missense probably damaging 0.99
R4299:Reln UTSW 5 21920487 missense probably damaging 0.99
R4518:Reln UTSW 5 21901743 missense probably benign 0.44
R4615:Reln UTSW 5 21972872 missense possibly damaging 0.95
R4713:Reln UTSW 5 22152463 missense probably benign 0.17
R4720:Reln UTSW 5 22286896 missense possibly damaging 0.71
R4721:Reln UTSW 5 21919222 missense probably damaging 0.99
R4771:Reln UTSW 5 22049700 missense probably damaging 1.00
R4794:Reln UTSW 5 22344185 missense probably damaging 0.98
R4840:Reln UTSW 5 22018846 splice site probably null
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4896:Reln UTSW 5 21955238 missense probably damaging 1.00
R4908:Reln UTSW 5 21979720 missense probably benign 0.02
R4912:Reln UTSW 5 21925193 missense probably benign 0.29
R4922:Reln UTSW 5 21995587 critical splice acceptor site probably null
R4975:Reln UTSW 5 21960426 missense probably damaging 1.00
R4976:Reln UTSW 5 21971870 missense probably benign 0.05
R5020:Reln UTSW 5 22034638 missense probably damaging 1.00
R5037:Reln UTSW 5 21948512 missense probably damaging 1.00
R5082:Reln UTSW 5 21896077 missense probably benign 0.00
R5119:Reln UTSW 5 21971870 missense probably benign 0.05
R5125:Reln UTSW 5 21913241 missense possibly damaging 0.78
R5137:Reln UTSW 5 21955181 missense probably damaging 1.00
R5152:Reln UTSW 5 21948629 missense probably damaging 1.00
R5154:Reln UTSW 5 21988765 missense probably damaging 0.99
R5259:Reln UTSW 5 22103397 missense possibly damaging 0.83
R5283:Reln UTSW 5 22011163 missense probably damaging 1.00
R5386:Reln UTSW 5 22039529 missense probably benign
R5400:Reln UTSW 5 21979714 missense probably damaging 1.00
R5478:Reln UTSW 5 22004203 missense probably benign 0.00
R5514:Reln UTSW 5 21971885 missense possibly damaging 0.93
R5529:Reln UTSW 5 21932715 missense possibly damaging 0.71
R5611:Reln UTSW 5 22039665 nonsense probably null
R5648:Reln UTSW 5 21998572 missense probably benign 0.04
R5649:Reln UTSW 5 21901625 missense probably benign 0.33
R5744:Reln UTSW 5 22106083 missense probably null 0.39
R5782:Reln UTSW 5 22018056 missense probably benign 0.01
R5815:Reln UTSW 5 21947433 missense probably damaging 0.99
R5838:Reln UTSW 5 21899113 missense probably damaging 0.97
R6162:Reln UTSW 5 21911050 missense probably damaging 1.00
R6219:Reln UTSW 5 21948596 missense probably damaging 1.00
R6259:Reln UTSW 5 22060333 missense probably damaging 0.99
R6279:Reln UTSW 5 21896841 missense probably damaging 1.00
R6299:Reln UTSW 5 22286944 missense possibly damaging 0.71
R6300:Reln UTSW 5 21896841 missense probably damaging 1.00
R6314:Reln UTSW 5 22152484 nonsense probably null
R6351:Reln UTSW 5 21901663 nonsense probably null
R6369:Reln UTSW 5 22051361 missense probably benign 0.03
R6371:Reln UTSW 5 21995513 missense probably benign
R6374:Reln UTSW 5 22080714 missense probably benign 0.06
R6425:Reln UTSW 5 21911020 nonsense probably null
R6442:Reln UTSW 5 21932776 missense probably benign
R6445:Reln UTSW 5 21919214 missense probably benign 0.05
R6554:Reln UTSW 5 21896840 missense probably damaging 1.00
R6641:Reln UTSW 5 21929134 missense probably damaging 1.00
R6768:Reln UTSW 5 21978907 missense probably damaging 0.99
R6859:Reln UTSW 5 22034570 missense probably damaging 1.00
R6896:Reln UTSW 5 21899179 missense probably benign 0.18
R6932:Reln UTSW 5 21985857 missense probably benign 0.00
R6948:Reln UTSW 5 21972035 missense probably damaging 1.00
R6959:Reln UTSW 5 21976564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGACCTAGTGCAGAATGGAC -3'
(R):5'- GTTGGAGACATACAGCAAGCCAGAC -3'

Sequencing Primer
(F):5'- CCTAGTGCAGAATGGACTGACTATC -3'
(R):5'- GAGTCTTGTTAAGCACCATACTTCTG -3'
Posted On2014-04-13