Incidental Mutation 'R1534:Olfr153'
ID166804
Institutional Source Beutler Lab
Gene Symbol Olfr153
Ensembl Gene ENSMUSG00000061520
Gene Nameolfactory receptor 153
SynonymsGA_x6K02T2Q125-49033418-49034341, MOR177-5, Olfr4-2, V5
MMRRC Submission 039573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #R1534 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87531796-87533053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87532672 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 213 (V213D)
Ref Sequence ENSEMBL: ENSMUSP00000149859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077471] [ENSMUST00000217113]
Predicted Effect probably damaging
Transcript: ENSMUST00000077471
AA Change: V213D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076681
Gene: ENSMUSG00000075151
AA Change: V213D

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 6e-48 PFAM
Pfam:7tm_1 40 289 2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217113
AA Change: V213D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,530,429 noncoding transcript Het
Adcy10 T C 1: 165,518,312 I310T probably damaging Het
Adcy5 T C 16: 35,253,259 V469A possibly damaging Het
Agrn C T 4: 156,176,684 C652Y probably damaging Het
Ankfn1 C T 11: 89,523,151 V133M probably damaging Het
Ankrd13c A G 3: 158,001,120 T448A probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
B4galt2 T C 4: 117,877,472 H233R probably damaging Het
Bpifb5 T G 2: 154,229,499 Y249D possibly damaging Het
Brd1 T C 15: 88,689,663 I1078V possibly damaging Het
Celsr3 A G 9: 108,848,884 E3104G probably damaging Het
Cyp2c69 T A 19: 39,851,149 K343N probably benign Het
Cyp4f18 T A 8: 71,992,955 D331V probably damaging Het
D130040H23Rik T C 8: 69,302,726 V261A possibly damaging Het
Dchs1 T C 7: 105,772,040 D391G probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Fat4 T C 3: 38,890,089 F1044L probably damaging Het
Frrs1 A T 3: 116,878,408 T52S probably benign Het
Gan G A 8: 117,187,429 V189I probably benign Het
Hnf1b A G 11: 83,893,583 probably benign Het
Itgae T C 11: 73,145,605 I1123T possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lrrc18 A G 14: 33,008,521 K6E possibly damaging Het
Map2 G A 1: 66,413,180 V492I probably benign Het
Mtr A T 13: 12,235,544 probably benign Het
Ncor1 G T 11: 62,378,504 A689E possibly damaging Het
Olfr668 G A 7: 104,925,414 L117F possibly damaging Het
Palm T G 10: 79,816,903 V42G probably damaging Het
Pcm1 G A 8: 41,287,701 V995I probably benign Het
Pfkp A G 13: 6,619,538 V215A probably damaging Het
Prkg2 T C 5: 98,994,561 Y238C probably damaging Het
Prr14 C T 7: 127,473,982 A167V probably benign Het
Ptprn A C 1: 75,257,943 probably null Het
Rexo2 A T 9: 48,468,890 I214N probably damaging Het
Rrbp1 A G 2: 143,988,313 S645P probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Satb2 A T 1: 56,948,233 C64* probably null Het
Sez6 A G 11: 77,963,045 Y347C probably damaging Het
Sos2 A G 12: 69,616,955 I585T probably damaging Het
Spg11 G A 2: 122,092,325 T881M probably damaging Het
Tiam1 A T 16: 89,867,508 probably null Het
Tmem136 A G 9: 43,111,628 W126R probably damaging Het
Top1 T C 2: 160,714,232 I537T probably damaging Het
Trappc6a A G 7: 19,514,213 S33G probably benign Het
Tspan11 G C 6: 127,949,805 V239L probably benign Het
Ubr4 T C 4: 139,428,151 V2190A possibly damaging Het
Usp28 A G 9: 48,985,506 D9G possibly damaging Het
Uty A G Y: 1,245,440 V35A probably benign Het
Vmn2r56 A G 7: 12,694,027 S771P probably benign Het
Wars2 C T 3: 99,216,861 A346V probably damaging Het
Zfp142 G T 1: 74,572,088 N849K probably benign Het
Zfp180 A T 7: 24,101,523 N66I probably benign Het
Other mutations in Olfr153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Olfr153 APN 2 87532285 missense probably benign 0.01
IGL02102:Olfr153 APN 2 87532461 missense probably benign
IGL02604:Olfr153 APN 2 87532605 missense probably damaging 0.98
IGL02695:Olfr153 APN 2 87532117 missense probably benign 0.00
IGL02961:Olfr153 APN 2 87532684 missense probably damaging 0.98
R0727:Olfr153 UTSW 2 87532901 nonsense probably null
R1699:Olfr153 UTSW 2 87532083 missense probably benign 0.07
R1885:Olfr153 UTSW 2 87532824 missense probably damaging 0.99
R3705:Olfr153 UTSW 2 87532068 missense probably benign 0.01
R5664:Olfr153 UTSW 2 87532834 missense probably benign 0.35
R6492:Olfr153 UTSW 2 87532741 missense possibly damaging 0.66
R6808:Olfr153 UTSW 2 87532941 missense probably benign
X0028:Olfr153 UTSW 2 87532039 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGGTGGGAACATCAGATGCTTTG -3'
(R):5'- AGACTACGCCTTGCTCTGTTATGC -3'

Sequencing Primer
(F):5'- GATACATACAACTTTGGCATTCCG -3'
(R):5'- tcacaatttcaaagccagcc -3'
Posted On2014-04-13