Incidental Mutation 'R1534:Rrbp1'
ID166806
Institutional Source Beutler Lab
Gene Symbol Rrbp1
Ensembl Gene ENSMUSG00000027422
Gene Nameribosome binding protein 1
SynonymsmRRp15b, mRRp47, mRRp41, 5730465C04Rik, 1700087N07Rik, mRRp0, mRRp15a, mRRp16.8, mRRp10, mRRp5.4, ES/130, mRRp2, mRRp1.8, p180
MMRRC Submission 039573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R1534 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location143947395-144011263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143988313 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 645 (S645P)
Ref Sequence ENSEMBL: ENSMUSP00000016072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016072] [ENSMUST00000037875]
Predicted Effect probably damaging
Transcript: ENSMUST00000016072
AA Change: S645P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000016072
Gene: ENSMUSG00000027422
AA Change: S645P

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Rib_recp_KP_reg 33 171 2.3e-40 PFAM
low complexity region 197 215 N/A INTRINSIC
internal_repeat_2 218 373 2.94e-114 PROSPERO
internal_repeat_1 219 406 7.79e-148 PROSPERO
internal_repeat_1 410 618 7.79e-148 PROSPERO
internal_repeat_2 449 692 2.94e-114 PROSPERO
coiled coil region 757 1126 N/A INTRINSIC
coiled coil region 1167 1321 N/A INTRINSIC
coiled coil region 1342 1455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037875
AA Change: S645P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040560
Gene: ENSMUSG00000027422
AA Change: S645P

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Rib_recp_KP_reg 33 173 2.8e-47 PFAM
low complexity region 197 215 N/A INTRINSIC
Blast:KISc 470 652 3e-13 BLAST
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,530,429 noncoding transcript Het
Adcy10 T C 1: 165,518,312 I310T probably damaging Het
Adcy5 T C 16: 35,253,259 V469A possibly damaging Het
Agrn C T 4: 156,176,684 C652Y probably damaging Het
Ankfn1 C T 11: 89,523,151 V133M probably damaging Het
Ankrd13c A G 3: 158,001,120 T448A probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
B4galt2 T C 4: 117,877,472 H233R probably damaging Het
Bpifb5 T G 2: 154,229,499 Y249D possibly damaging Het
Brd1 T C 15: 88,689,663 I1078V possibly damaging Het
Celsr3 A G 9: 108,848,884 E3104G probably damaging Het
Cyp2c69 T A 19: 39,851,149 K343N probably benign Het
Cyp4f18 T A 8: 71,992,955 D331V probably damaging Het
D130040H23Rik T C 8: 69,302,726 V261A possibly damaging Het
Dchs1 T C 7: 105,772,040 D391G probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Fat4 T C 3: 38,890,089 F1044L probably damaging Het
Frrs1 A T 3: 116,878,408 T52S probably benign Het
Gan G A 8: 117,187,429 V189I probably benign Het
Hnf1b A G 11: 83,893,583 probably benign Het
Itgae T C 11: 73,145,605 I1123T possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lrrc18 A G 14: 33,008,521 K6E possibly damaging Het
Map2 G A 1: 66,413,180 V492I probably benign Het
Mtr A T 13: 12,235,544 probably benign Het
Ncor1 G T 11: 62,378,504 A689E possibly damaging Het
Olfr153 T A 2: 87,532,672 V213D probably damaging Het
Olfr668 G A 7: 104,925,414 L117F possibly damaging Het
Palm T G 10: 79,816,903 V42G probably damaging Het
Pcm1 G A 8: 41,287,701 V995I probably benign Het
Pfkp A G 13: 6,619,538 V215A probably damaging Het
Prkg2 T C 5: 98,994,561 Y238C probably damaging Het
Prr14 C T 7: 127,473,982 A167V probably benign Het
Ptprn A C 1: 75,257,943 probably null Het
Rexo2 A T 9: 48,468,890 I214N probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Satb2 A T 1: 56,948,233 C64* probably null Het
Sez6 A G 11: 77,963,045 Y347C probably damaging Het
Sos2 A G 12: 69,616,955 I585T probably damaging Het
Spg11 G A 2: 122,092,325 T881M probably damaging Het
Tiam1 A T 16: 89,867,508 probably null Het
Tmem136 A G 9: 43,111,628 W126R probably damaging Het
Top1 T C 2: 160,714,232 I537T probably damaging Het
Trappc6a A G 7: 19,514,213 S33G probably benign Het
Tspan11 G C 6: 127,949,805 V239L probably benign Het
Ubr4 T C 4: 139,428,151 V2190A possibly damaging Het
Usp28 A G 9: 48,985,506 D9G possibly damaging Het
Uty A G Y: 1,245,440 V35A probably benign Het
Vmn2r56 A G 7: 12,694,027 S771P probably benign Het
Wars2 C T 3: 99,216,861 A346V probably damaging Het
Zfp142 G T 1: 74,572,088 N849K probably benign Het
Zfp180 A T 7: 24,101,523 N66I probably benign Het
Other mutations in Rrbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Rrbp1 APN 2 143968618 missense possibly damaging 0.93
IGL01636:Rrbp1 APN 2 143947895 unclassified probably benign
IGL01923:Rrbp1 APN 2 143990161 missense probably damaging 1.00
IGL02513:Rrbp1 APN 2 143988430 missense possibly damaging 0.55
IGL02548:Rrbp1 APN 2 143949759 splice site probably benign
IGL02678:Rrbp1 APN 2 143990187 missense probably damaging 0.98
FR4449:Rrbp1 UTSW 2 143967456 frame shift probably null
PIT4378001:Rrbp1 UTSW 2 143974540 missense probably benign 0.00
R0127:Rrbp1 UTSW 2 143989944 missense probably benign 0.21
R0611:Rrbp1 UTSW 2 143988516 missense probably damaging 1.00
R0881:Rrbp1 UTSW 2 143953253 missense probably benign 0.09
R1439:Rrbp1 UTSW 2 143955112 critical splice donor site probably null
R1604:Rrbp1 UTSW 2 143989390 missense probably damaging 0.99
R1920:Rrbp1 UTSW 2 143988291 missense probably benign 0.16
R1921:Rrbp1 UTSW 2 143988291 missense probably benign 0.16
R2152:Rrbp1 UTSW 2 143954198 missense possibly damaging 0.75
R2153:Rrbp1 UTSW 2 143954198 missense possibly damaging 0.75
R2319:Rrbp1 UTSW 2 143957559 missense probably benign 0.01
R2850:Rrbp1 UTSW 2 143949349 missense probably benign 0.09
R2864:Rrbp1 UTSW 2 143957637 missense probably damaging 0.99
R3433:Rrbp1 UTSW 2 143952280 splice site probably benign
R3707:Rrbp1 UTSW 2 143953277 missense probably benign 0.01
R3837:Rrbp1 UTSW 2 143989558 missense probably damaging 1.00
R4073:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4074:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4076:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4279:Rrbp1 UTSW 2 143963108 missense probably benign 0.16
R4583:Rrbp1 UTSW 2 143988751 missense probably benign 0.03
R4820:Rrbp1 UTSW 2 143964765 missense possibly damaging 0.78
R4829:Rrbp1 UTSW 2 143989687 missense probably benign 0.18
R4836:Rrbp1 UTSW 2 143988417 missense possibly damaging 0.75
R5589:Rrbp1 UTSW 2 143989966 missense probably benign 0.16
R5801:Rrbp1 UTSW 2 143989783 missense probably damaging 1.00
R5806:Rrbp1 UTSW 2 143963331 missense probably benign 0.16
R5955:Rrbp1 UTSW 2 143949677 missense probably benign 0.06
R6102:Rrbp1 UTSW 2 143988393 missense probably damaging 1.00
R6368:Rrbp1 UTSW 2 143989555 missense probably damaging 1.00
R6916:Rrbp1 UTSW 2 143974598 missense probably benign 0.03
R7022:Rrbp1 UTSW 2 143957802 intron probably null
R7061:Rrbp1 UTSW 2 143989167 missense possibly damaging 0.61
R7136:Rrbp1 UTSW 2 143949680 missense probably benign 0.16
R7291:Rrbp1 UTSW 2 143969462 missense probably benign 0.09
R7361:Rrbp1 UTSW 2 143967444 missense probably benign 0.01
Z1088:Rrbp1 UTSW 2 143974486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAATGGCAAACAGCAGAGCAC -3'
(R):5'- TGGAAATCCCAACCAAGGCAAGAAG -3'

Sequencing Primer
(F):5'- AGTCACAGTCAGCGGCTTTC -3'
(R):5'- CCAAGGCAAGAAGGGGGAG -3'
Posted On2014-04-13