Incidental Mutation 'R1534:Bpifb5'
ID166807
Institutional Source Beutler Lab
Gene Symbol Bpifb5
Ensembl Gene ENSMUSG00000038572
Gene NameBPI fold containing family B, member 5
SynonymsBC018465
MMRRC Submission 039573-MU
Accession Numbers

Genbank: NM_144890; MGI: 2385160

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1534 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154223742-154240902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 154229499 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 249 (Y249D)
Ref Sequence ENSEMBL: ENSMUSP00000046683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045959]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045959
AA Change: Y249D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046683
Gene: ENSMUSG00000038572
AA Change: Y249D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
coiled coil region 26 54 N/A INTRINSIC
Pfam:LBP_BPI_CETP 94 231 7.6e-14 PFAM
Blast:BPI2 291 488 4e-91 BLAST
SCOP:d1ewfa2 433 486 8e-3 SMART
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,530,429 noncoding transcript Het
Adcy10 T C 1: 165,518,312 I310T probably damaging Het
Adcy5 T C 16: 35,253,259 V469A possibly damaging Het
Agrn C T 4: 156,176,684 C652Y probably damaging Het
Ankfn1 C T 11: 89,523,151 V133M probably damaging Het
Ankrd13c A G 3: 158,001,120 T448A probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
B4galt2 T C 4: 117,877,472 H233R probably damaging Het
Brd1 T C 15: 88,689,663 I1078V possibly damaging Het
Celsr3 A G 9: 108,848,884 E3104G probably damaging Het
Cyp2c69 T A 19: 39,851,149 K343N probably benign Het
Cyp4f18 T A 8: 71,992,955 D331V probably damaging Het
D130040H23Rik T C 8: 69,302,726 V261A possibly damaging Het
Dchs1 T C 7: 105,772,040 D391G probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Fat4 T C 3: 38,890,089 F1044L probably damaging Het
Frrs1 A T 3: 116,878,408 T52S probably benign Het
Gan G A 8: 117,187,429 V189I probably benign Het
Hnf1b A G 11: 83,893,583 probably benign Het
Itgae T C 11: 73,145,605 I1123T possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lrrc18 A G 14: 33,008,521 K6E possibly damaging Het
Map2 G A 1: 66,413,180 V492I probably benign Het
Mtr A T 13: 12,235,544 probably benign Het
Ncor1 G T 11: 62,378,504 A689E possibly damaging Het
Olfr153 T A 2: 87,532,672 V213D probably damaging Het
Olfr668 G A 7: 104,925,414 L117F possibly damaging Het
Palm T G 10: 79,816,903 V42G probably damaging Het
Pcm1 G A 8: 41,287,701 V995I probably benign Het
Pfkp A G 13: 6,619,538 V215A probably damaging Het
Prkg2 T C 5: 98,994,561 Y238C probably damaging Het
Prr14 C T 7: 127,473,982 A167V probably benign Het
Ptprn A C 1: 75,257,943 probably null Het
Rexo2 A T 9: 48,468,890 I214N probably damaging Het
Rrbp1 A G 2: 143,988,313 S645P probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Satb2 A T 1: 56,948,233 C64* probably null Het
Sez6 A G 11: 77,963,045 Y347C probably damaging Het
Sos2 A G 12: 69,616,955 I585T probably damaging Het
Spg11 G A 2: 122,092,325 T881M probably damaging Het
Tiam1 A T 16: 89,867,508 probably null Het
Tmem136 A G 9: 43,111,628 W126R probably damaging Het
Top1 T C 2: 160,714,232 I537T probably damaging Het
Trappc6a A G 7: 19,514,213 S33G probably benign Het
Tspan11 G C 6: 127,949,805 V239L probably benign Het
Ubr4 T C 4: 139,428,151 V2190A possibly damaging Het
Usp28 A G 9: 48,985,506 D9G possibly damaging Het
Uty A G Y: 1,245,440 V35A probably benign Het
Vmn2r56 A G 7: 12,694,027 S771P probably benign Het
Wars2 C T 3: 99,216,861 A346V probably damaging Het
Zfp142 G T 1: 74,572,088 N849K probably benign Het
Zfp180 A T 7: 24,101,523 N66I probably benign Het
Other mutations in Bpifb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Bpifb5 APN 2 154233249 missense possibly damaging 0.86
IGL01676:Bpifb5 APN 2 154229049 missense possibly damaging 0.71
IGL02065:Bpifb5 APN 2 154227183 missense probably damaging 0.98
IGL02141:Bpifb5 APN 2 154229557 splice site probably null
IGL02244:Bpifb5 APN 2 154225148 missense possibly damaging 0.93
IGL03118:Bpifb5 APN 2 154236753 splice site probably benign
A4554:Bpifb5 UTSW 2 154227180 missense possibly damaging 0.71
R0022:Bpifb5 UTSW 2 154230348 missense probably damaging 0.98
R0492:Bpifb5 UTSW 2 154228900 missense probably benign 0.11
R0654:Bpifb5 UTSW 2 154228900 missense probably benign 0.11
R0692:Bpifb5 UTSW 2 154234696 missense probably benign 0.33
R0707:Bpifb5 UTSW 2 154228900 missense probably benign 0.11
R0898:Bpifb5 UTSW 2 154233334 missense probably benign
R1539:Bpifb5 UTSW 2 154223856 missense probably benign
R1874:Bpifb5 UTSW 2 154227202 splice site probably benign
R1971:Bpifb5 UTSW 2 154230344 missense probably benign 0.18
R2001:Bpifb5 UTSW 2 154233279 missense possibly damaging 0.53
R3013:Bpifb5 UTSW 2 154228855 missense possibly damaging 0.59
R3916:Bpifb5 UTSW 2 154228181 missense probably benign
R4499:Bpifb5 UTSW 2 154240758 missense possibly damaging 0.53
R5250:Bpifb5 UTSW 2 154224961 missense probably benign
R6301:Bpifb5 UTSW 2 154230219 missense possibly damaging 0.73
R6836:Bpifb5 UTSW 2 154228065 missense probably benign 0.02
R6869:Bpifb5 UTSW 2 154233223 missense probably benign 0.33
R7014:Bpifb5 UTSW 2 154224956 nonsense probably null
T0975:Bpifb5 UTSW 2 154229464 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTTATTTCAGGAGGCCCATGCTCAG -3'
(R):5'- TGCCTACCTTCCGTTACAGACAGAC -3'

Sequencing Primer
(F):5'- GCCCATGCTCAGCCATC -3'
(R):5'- CATTCTCGGAGCAGACTCAG -3'
Posted On2014-04-13