Incidental Mutation 'R1534:Klra3'
ID166817
Institutional Source Beutler Lab
Gene Symbol Klra3
Ensembl Gene ENSMUSG00000067591
Gene Namekiller cell lectin-like receptor, subfamily A, member 3
SynonymsNK-2.1, Nk2.1, Ly49C, Nk-2, Nk2, Ly49c, 5E6
MMRRC Submission 039573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.018) question?
Stock #R1534 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location130323289-130337574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 130333144 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 138 (R138G)
Ref Sequence ENSEMBL: ENSMUSP00000107629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088017] [ENSMUST00000111998]
Predicted Effect probably benign
Transcript: ENSMUST00000088017
AA Change: R138G

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000085333
Gene: ENSMUSG00000067591
AA Change: R138G

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 117 1e-7 BLAST
CLECT 143 258 7.11e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111998
AA Change: R138G

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107629
Gene: ENSMUSG00000067591
AA Change: R138G

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 117 1e-7 BLAST
CLECT 143 258 7.11e-16 SMART
Meta Mutation Damage Score 0.1096 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,530,429 noncoding transcript Het
Adcy10 T C 1: 165,518,312 I310T probably damaging Het
Adcy5 T C 16: 35,253,259 V469A possibly damaging Het
Agrn C T 4: 156,176,684 C652Y probably damaging Het
Ankfn1 C T 11: 89,523,151 V133M probably damaging Het
Ankrd13c A G 3: 158,001,120 T448A probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
B4galt2 T C 4: 117,877,472 H233R probably damaging Het
Bpifb5 T G 2: 154,229,499 Y249D possibly damaging Het
Brd1 T C 15: 88,689,663 I1078V possibly damaging Het
Celsr3 A G 9: 108,848,884 E3104G probably damaging Het
Cyp2c69 T A 19: 39,851,149 K343N probably benign Het
Cyp4f18 T A 8: 71,992,955 D331V probably damaging Het
D130040H23Rik T C 8: 69,302,726 V261A possibly damaging Het
Dchs1 T C 7: 105,772,040 D391G probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Fat4 T C 3: 38,890,089 F1044L probably damaging Het
Frrs1 A T 3: 116,878,408 T52S probably benign Het
Gan G A 8: 117,187,429 V189I probably benign Het
Hnf1b A G 11: 83,893,583 probably benign Het
Itgae T C 11: 73,145,605 I1123T possibly damaging Het
Lrrc18 A G 14: 33,008,521 K6E possibly damaging Het
Map2 G A 1: 66,413,180 V492I probably benign Het
Mtr A T 13: 12,235,544 probably benign Het
Ncor1 G T 11: 62,378,504 A689E possibly damaging Het
Olfr153 T A 2: 87,532,672 V213D probably damaging Het
Olfr668 G A 7: 104,925,414 L117F possibly damaging Het
Palm T G 10: 79,816,903 V42G probably damaging Het
Pcm1 G A 8: 41,287,701 V995I probably benign Het
Pfkp A G 13: 6,619,538 V215A probably damaging Het
Prkg2 T C 5: 98,994,561 Y238C probably damaging Het
Prr14 C T 7: 127,473,982 A167V probably benign Het
Ptprn A C 1: 75,257,943 probably null Het
Rexo2 A T 9: 48,468,890 I214N probably damaging Het
Rrbp1 A G 2: 143,988,313 S645P probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Satb2 A T 1: 56,948,233 C64* probably null Het
Sez6 A G 11: 77,963,045 Y347C probably damaging Het
Sos2 A G 12: 69,616,955 I585T probably damaging Het
Spg11 G A 2: 122,092,325 T881M probably damaging Het
Tiam1 A T 16: 89,867,508 probably null Het
Tmem136 A G 9: 43,111,628 W126R probably damaging Het
Top1 T C 2: 160,714,232 I537T probably damaging Het
Trappc6a A G 7: 19,514,213 S33G probably benign Het
Tspan11 G C 6: 127,949,805 V239L probably benign Het
Ubr4 T C 4: 139,428,151 V2190A possibly damaging Het
Usp28 A G 9: 48,985,506 D9G possibly damaging Het
Uty A G Y: 1,245,440 V35A probably benign Het
Vmn2r56 A G 7: 12,694,027 S771P probably benign Het
Wars2 C T 3: 99,216,861 A346V probably damaging Het
Zfp142 G T 1: 74,572,088 N849K probably benign Het
Zfp180 A T 7: 24,101,523 N66I probably benign Het
Other mutations in Klra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Klra3 APN 6 130327144 missense probably benign 0.26
R0004:Klra3 UTSW 6 130323687 missense probably damaging 1.00
R1532:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1533:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1536:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1547:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1548:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1566:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1567:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1769:Klra3 UTSW 6 130330263 critical splice acceptor site probably null
R1772:Klra3 UTSW 6 130323708 missense probably benign
R1806:Klra3 UTSW 6 130327070 missense probably damaging 0.99
R2131:Klra3 UTSW 6 130335775 missense probably benign 0.07
R2138:Klra3 UTSW 6 130333158 missense probably benign 0.00
R2152:Klra3 UTSW 6 130333144 missense probably benign 0.12
R2154:Klra3 UTSW 6 130333144 missense probably benign 0.12
R2906:Klra3 UTSW 6 130333339 missense probably damaging 0.99
R2907:Klra3 UTSW 6 130333339 missense probably damaging 0.99
R4287:Klra3 UTSW 6 130334302 missense probably benign 0.08
R4732:Klra3 UTSW 6 130327132 missense possibly damaging 0.94
R4733:Klra3 UTSW 6 130327132 missense possibly damaging 0.94
R4829:Klra3 UTSW 6 130323616 missense probably benign 0.05
R5308:Klra3 UTSW 6 130334307 splice site probably null
R6701:Klra3 UTSW 6 130330253 missense probably benign 0.01
R7019:Klra3 UTSW 6 130327124 missense probably damaging 1.00
X0052:Klra3 UTSW 6 130333180 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCCTCATTCACTGTGACACTGAC -3'
(R):5'- AGCAACATGCAAAGGGCTTTCAAC -3'

Sequencing Primer
(F):5'- GAGTGCCAAAGAGAACTTTCCTTC -3'
(R):5'- TGCAAAGGGCTTTCAACTTAAAGG -3'
Posted On2014-04-13