Incidental Mutation 'R1534:Vmn2r56'
ID166818
Institutional Source Beutler Lab
Gene Symbol Vmn2r56
Ensembl Gene ENSMUSG00000090762
Gene Namevomeronasal 2, receptor 56
SynonymsEG629079
MMRRC Submission 039573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1534 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12693998-12733105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12694027 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 771 (S771P)
Ref Sequence ENSEMBL: ENSMUSP00000129566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163852]
Predicted Effect probably benign
Transcript: ENSMUST00000163852
AA Change: S771P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129566
Gene: ENSMUSG00000090762
AA Change: S771P

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 1.9e-55 PFAM
Pfam:NCD3G 439 492 6.4e-20 PFAM
Pfam:7tm_3 523 760 1.3e-53 PFAM
Meta Mutation Damage Score 0.1536 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,530,429 noncoding transcript Het
Adcy10 T C 1: 165,518,312 I310T probably damaging Het
Adcy5 T C 16: 35,253,259 V469A possibly damaging Het
Agrn C T 4: 156,176,684 C652Y probably damaging Het
Ankfn1 C T 11: 89,523,151 V133M probably damaging Het
Ankrd13c A G 3: 158,001,120 T448A probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
B4galt2 T C 4: 117,877,472 H233R probably damaging Het
Bpifb5 T G 2: 154,229,499 Y249D possibly damaging Het
Brd1 T C 15: 88,689,663 I1078V possibly damaging Het
Celsr3 A G 9: 108,848,884 E3104G probably damaging Het
Cyp2c69 T A 19: 39,851,149 K343N probably benign Het
Cyp4f18 T A 8: 71,992,955 D331V probably damaging Het
D130040H23Rik T C 8: 69,302,726 V261A possibly damaging Het
Dchs1 T C 7: 105,772,040 D391G probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Fat4 T C 3: 38,890,089 F1044L probably damaging Het
Frrs1 A T 3: 116,878,408 T52S probably benign Het
Gan G A 8: 117,187,429 V189I probably benign Het
Hnf1b A G 11: 83,893,583 probably benign Het
Itgae T C 11: 73,145,605 I1123T possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lrrc18 A G 14: 33,008,521 K6E possibly damaging Het
Map2 G A 1: 66,413,180 V492I probably benign Het
Mtr A T 13: 12,235,544 probably benign Het
Ncor1 G T 11: 62,378,504 A689E possibly damaging Het
Olfr153 T A 2: 87,532,672 V213D probably damaging Het
Olfr668 G A 7: 104,925,414 L117F possibly damaging Het
Palm T G 10: 79,816,903 V42G probably damaging Het
Pcm1 G A 8: 41,287,701 V995I probably benign Het
Pfkp A G 13: 6,619,538 V215A probably damaging Het
Prkg2 T C 5: 98,994,561 Y238C probably damaging Het
Prr14 C T 7: 127,473,982 A167V probably benign Het
Ptprn A C 1: 75,257,943 probably null Het
Rexo2 A T 9: 48,468,890 I214N probably damaging Het
Rrbp1 A G 2: 143,988,313 S645P probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Satb2 A T 1: 56,948,233 C64* probably null Het
Sez6 A G 11: 77,963,045 Y347C probably damaging Het
Sos2 A G 12: 69,616,955 I585T probably damaging Het
Spg11 G A 2: 122,092,325 T881M probably damaging Het
Tiam1 A T 16: 89,867,508 probably null Het
Tmem136 A G 9: 43,111,628 W126R probably damaging Het
Top1 T C 2: 160,714,232 I537T probably damaging Het
Trappc6a A G 7: 19,514,213 S33G probably benign Het
Tspan11 G C 6: 127,949,805 V239L probably benign Het
Ubr4 T C 4: 139,428,151 V2190A possibly damaging Het
Usp28 A G 9: 48,985,506 D9G possibly damaging Het
Uty A G Y: 1,245,440 V35A probably benign Het
Wars2 C T 3: 99,216,861 A346V probably damaging Het
Zfp142 G T 1: 74,572,088 N849K probably benign Het
Zfp180 A T 7: 24,101,523 N66I probably benign Het
Other mutations in Vmn2r56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Vmn2r56 APN 7 12715499 missense probably benign 0.38
IGL01060:Vmn2r56 APN 7 12713089 missense probably damaging 0.97
IGL01433:Vmn2r56 APN 7 12715614 missense probably benign
IGL01859:Vmn2r56 APN 7 12716005 missense probably damaging 1.00
IGL01874:Vmn2r56 APN 7 12715675 missense probably benign 0.03
IGL02208:Vmn2r56 APN 7 12715481 missense probably benign 0.01
PIT4445001:Vmn2r56 UTSW 7 12715226 critical splice donor site probably null
R0077:Vmn2r56 UTSW 7 12715405 missense probably benign 0.01
R0278:Vmn2r56 UTSW 7 12715717 missense probably damaging 0.99
R0512:Vmn2r56 UTSW 7 12715423 missense probably benign
R0658:Vmn2r56 UTSW 7 12710308 missense probably benign 0.10
R0789:Vmn2r56 UTSW 7 12732835 missense probably damaging 1.00
R1731:Vmn2r56 UTSW 7 12733045 missense probably benign
R1817:Vmn2r56 UTSW 7 12715615 missense probably benign
R2047:Vmn2r56 UTSW 7 12732991 missense probably damaging 1.00
R2139:Vmn2r56 UTSW 7 12712963 nonsense probably null
R2160:Vmn2r56 UTSW 7 12694219 missense probably benign 0.43
R2449:Vmn2r56 UTSW 7 12694155 missense possibly damaging 0.67
R2877:Vmn2r56 UTSW 7 12711027 missense probably benign
R2878:Vmn2r56 UTSW 7 12711027 missense probably benign
R4910:Vmn2r56 UTSW 7 12715535 missense possibly damaging 0.64
R5072:Vmn2r56 UTSW 7 12694056 missense probably benign 0.40
R5340:Vmn2r56 UTSW 7 12715872 missense probably damaging 1.00
R5697:Vmn2r56 UTSW 7 12715990 missense probably damaging 1.00
R5798:Vmn2r56 UTSW 7 12712965 missense probably benign 0.00
R6166:Vmn2r56 UTSW 7 12694020 missense probably damaging 1.00
R6290:Vmn2r56 UTSW 7 12694882 missense probably damaging 1.00
R6458:Vmn2r56 UTSW 7 12694057 missense probably damaging 0.99
R6751:Vmn2r56 UTSW 7 12694792 missense probably benign
R6978:Vmn2r56 UTSW 7 12715406 missense probably benign 0.01
R7090:Vmn2r56 UTSW 7 12715327 missense probably damaging 1.00
R7200:Vmn2r56 UTSW 7 12710332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACAGGACAGTCAGTGACCATC -3'
(R):5'- GAGACCAAGTTCCTCACCTTCAGC -3'

Sequencing Primer
(F):5'- GACAGTCAGTGACCATCTATATGTCC -3'
(R):5'- CATGTTGCTCTTCTGCAGTG -3'
Posted On2014-04-13