Incidental Mutation 'R1534:Cyp4f18'
ID166828
Institutional Source Beutler Lab
Gene Symbol Cyp4f18
Ensembl Gene ENSMUSG00000003484
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 18
Synonyms1810054N16Rik
MMRRC Submission 039573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1534 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71988482-72009626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71992955 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 331 (D331V)
Ref Sequence ENSEMBL: ENSMUSP00000003574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003574]
Predicted Effect probably damaging
Transcript: ENSMUST00000003574
AA Change: D331V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003574
Gene: ENSMUSG00000003484
AA Change: D331V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 52 516 2.7e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136878
Predicted Effect probably benign
Transcript: ENSMUST00000141975
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F11, is approximately 16 kb away. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered leukotriene B4 metabolism but show no significant alterations in inflammatory cell infiltration or injury following renal ischemia-reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,530,429 noncoding transcript Het
Adcy10 T C 1: 165,518,312 I310T probably damaging Het
Adcy5 T C 16: 35,253,259 V469A possibly damaging Het
Agrn C T 4: 156,176,684 C652Y probably damaging Het
Ankfn1 C T 11: 89,523,151 V133M probably damaging Het
Ankrd13c A G 3: 158,001,120 T448A probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
B4galt2 T C 4: 117,877,472 H233R probably damaging Het
Bpifb5 T G 2: 154,229,499 Y249D possibly damaging Het
Brd1 T C 15: 88,689,663 I1078V possibly damaging Het
Celsr3 A G 9: 108,848,884 E3104G probably damaging Het
Cyp2c69 T A 19: 39,851,149 K343N probably benign Het
D130040H23Rik T C 8: 69,302,726 V261A possibly damaging Het
Dchs1 T C 7: 105,772,040 D391G probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Fat4 T C 3: 38,890,089 F1044L probably damaging Het
Frrs1 A T 3: 116,878,408 T52S probably benign Het
Gan G A 8: 117,187,429 V189I probably benign Het
Hnf1b A G 11: 83,893,583 probably benign Het
Itgae T C 11: 73,145,605 I1123T possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lrrc18 A G 14: 33,008,521 K6E possibly damaging Het
Map2 G A 1: 66,413,180 V492I probably benign Het
Mtr A T 13: 12,235,544 probably benign Het
Ncor1 G T 11: 62,378,504 A689E possibly damaging Het
Olfr153 T A 2: 87,532,672 V213D probably damaging Het
Olfr668 G A 7: 104,925,414 L117F possibly damaging Het
Palm T G 10: 79,816,903 V42G probably damaging Het
Pcm1 G A 8: 41,287,701 V995I probably benign Het
Pfkp A G 13: 6,619,538 V215A probably damaging Het
Prkg2 T C 5: 98,994,561 Y238C probably damaging Het
Prr14 C T 7: 127,473,982 A167V probably benign Het
Ptprn A C 1: 75,257,943 probably null Het
Rexo2 A T 9: 48,468,890 I214N probably damaging Het
Rrbp1 A G 2: 143,988,313 S645P probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Satb2 A T 1: 56,948,233 C64* probably null Het
Sez6 A G 11: 77,963,045 Y347C probably damaging Het
Sos2 A G 12: 69,616,955 I585T probably damaging Het
Spg11 G A 2: 122,092,325 T881M probably damaging Het
Tiam1 A T 16: 89,867,508 probably null Het
Tmem136 A G 9: 43,111,628 W126R probably damaging Het
Top1 T C 2: 160,714,232 I537T probably damaging Het
Trappc6a A G 7: 19,514,213 S33G probably benign Het
Tspan11 G C 6: 127,949,805 V239L probably benign Het
Ubr4 T C 4: 139,428,151 V2190A possibly damaging Het
Usp28 A G 9: 48,985,506 D9G possibly damaging Het
Uty A G Y: 1,245,440 V35A probably benign Het
Vmn2r56 A G 7: 12,694,027 S771P probably benign Het
Wars2 C T 3: 99,216,861 A346V probably damaging Het
Zfp142 G T 1: 74,572,088 N849K probably benign Het
Zfp180 A T 7: 24,101,523 N66I probably benign Het
Other mutations in Cyp4f18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Cyp4f18 APN 8 71989927 missense probably damaging 0.96
IGL01465:Cyp4f18 APN 8 72002444 missense probably benign
IGL01863:Cyp4f18 APN 8 71989926 missense possibly damaging 0.49
IGL02403:Cyp4f18 APN 8 71998228 missense probably damaging 0.97
IGL03244:Cyp4f18 APN 8 71988645 missense probably benign 0.12
R0226:Cyp4f18 UTSW 8 71989775 splice site probably benign
R0310:Cyp4f18 UTSW 8 72001012 splice site probably benign
R0486:Cyp4f18 UTSW 8 71996017 missense probably benign 0.02
R0506:Cyp4f18 UTSW 8 71996000 missense probably benign 0.00
R0547:Cyp4f18 UTSW 8 71996010 missense probably benign 0.00
R0689:Cyp4f18 UTSW 8 71995968 missense probably benign
R0721:Cyp4f18 UTSW 8 72001135 missense probably benign 0.02
R2087:Cyp4f18 UTSW 8 72000988 missense probably benign
R2902:Cyp4f18 UTSW 8 72002411 missense probably damaging 0.96
R3149:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3150:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3177:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3277:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3906:Cyp4f18 UTSW 8 72001082 splice site probably benign
R3916:Cyp4f18 UTSW 8 71996037 missense probably benign 0.03
R3953:Cyp4f18 UTSW 8 72000957 missense probably damaging 1.00
R4815:Cyp4f18 UTSW 8 71995995 missense possibly damaging 0.52
R4915:Cyp4f18 UTSW 8 72009054 missense probably damaging 1.00
R5086:Cyp4f18 UTSW 8 72002432 missense probably benign 0.00
R5113:Cyp4f18 UTSW 8 71989058 critical splice donor site probably null
R5202:Cyp4f18 UTSW 8 72009096 missense probably benign 0.03
R5761:Cyp4f18 UTSW 8 71996131 missense probably damaging 0.99
R6187:Cyp4f18 UTSW 8 71993186 missense probably damaging 0.98
R6664:Cyp4f18 UTSW 8 71989915 missense probably benign 0.21
R6944:Cyp4f18 UTSW 8 71989894 missense probably benign 0.03
R6978:Cyp4f18 UTSW 8 72002496 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGCAAATGCATACCTGCTCGTC -3'
(R):5'- GTTCCTGTGAACTGTGACAGAGAGG -3'

Sequencing Primer
(F):5'- CTTTTCACTAGAGAAAAGAGCAGG -3'
(R):5'- CTGTGACAGAGAGGGCAGATG -3'
Posted On2014-04-13