Incidental Mutation 'R1534:Palm'
ID166833
Institutional Source Beutler Lab
Gene Symbol Palm
Ensembl Gene ENSMUSG00000035863
Gene Nameparalemmin
Synonyms
MMRRC Submission 039573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1534 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79793572-79820896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 79816903 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 42 (V42G)
Ref Sequence ENSEMBL: ENSMUSP00000151929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046945] [ENSMUST00000105379] [ENSMUST00000169041] [ENSMUST00000218631] [ENSMUST00000218857] [ENSMUST00000220365]
Predicted Effect probably damaging
Transcript: ENSMUST00000046945
AA Change: V204G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040596
Gene: ENSMUSG00000035863
AA Change: V204G

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
Pfam:Paralemmin 71 383 4.2e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105379
SMART Domains Protein: ENSMUSP00000101018
Gene: ENSMUSG00000035863

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
Pfam:Paralemmin 70 339 1.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169041
SMART Domains Protein: ENSMUSP00000130071
Gene: ENSMUSG00000035852

DomainStartEndE-ValueType
low complexity region 262 284 N/A INTRINSIC
Pfam:AKAP2_C 294 643 1.7e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218631
Predicted Effect probably benign
Transcript: ENSMUST00000218857
Predicted Effect probably damaging
Transcript: ENSMUST00000220365
AA Change: V42G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paralemmin protein family. The product of this gene is a prenylated and palmitoylated phosphoprotein that associates with the cytoplasmic face of plasma membranes and is implicated in plasma membrane dynamics in neurons and other cell types. Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,530,429 noncoding transcript Het
Adcy10 T C 1: 165,518,312 I310T probably damaging Het
Adcy5 T C 16: 35,253,259 V469A possibly damaging Het
Agrn C T 4: 156,176,684 C652Y probably damaging Het
Ankfn1 C T 11: 89,523,151 V133M probably damaging Het
Ankrd13c A G 3: 158,001,120 T448A probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
B4galt2 T C 4: 117,877,472 H233R probably damaging Het
Bpifb5 T G 2: 154,229,499 Y249D possibly damaging Het
Brd1 T C 15: 88,689,663 I1078V possibly damaging Het
Celsr3 A G 9: 108,848,884 E3104G probably damaging Het
Cyp2c69 T A 19: 39,851,149 K343N probably benign Het
Cyp4f18 T A 8: 71,992,955 D331V probably damaging Het
D130040H23Rik T C 8: 69,302,726 V261A possibly damaging Het
Dchs1 T C 7: 105,772,040 D391G probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Fat4 T C 3: 38,890,089 F1044L probably damaging Het
Frrs1 A T 3: 116,878,408 T52S probably benign Het
Gan G A 8: 117,187,429 V189I probably benign Het
Hnf1b A G 11: 83,893,583 probably benign Het
Itgae T C 11: 73,145,605 I1123T possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lrrc18 A G 14: 33,008,521 K6E possibly damaging Het
Map2 G A 1: 66,413,180 V492I probably benign Het
Mtr A T 13: 12,235,544 probably benign Het
Ncor1 G T 11: 62,378,504 A689E possibly damaging Het
Olfr153 T A 2: 87,532,672 V213D probably damaging Het
Olfr668 G A 7: 104,925,414 L117F possibly damaging Het
Pcm1 G A 8: 41,287,701 V995I probably benign Het
Pfkp A G 13: 6,619,538 V215A probably damaging Het
Prkg2 T C 5: 98,994,561 Y238C probably damaging Het
Prr14 C T 7: 127,473,982 A167V probably benign Het
Ptprn A C 1: 75,257,943 probably null Het
Rexo2 A T 9: 48,468,890 I214N probably damaging Het
Rrbp1 A G 2: 143,988,313 S645P probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Satb2 A T 1: 56,948,233 C64* probably null Het
Sez6 A G 11: 77,963,045 Y347C probably damaging Het
Sos2 A G 12: 69,616,955 I585T probably damaging Het
Spg11 G A 2: 122,092,325 T881M probably damaging Het
Tiam1 A T 16: 89,867,508 probably null Het
Tmem136 A G 9: 43,111,628 W126R probably damaging Het
Top1 T C 2: 160,714,232 I537T probably damaging Het
Trappc6a A G 7: 19,514,213 S33G probably benign Het
Tspan11 G C 6: 127,949,805 V239L probably benign Het
Ubr4 T C 4: 139,428,151 V2190A possibly damaging Het
Usp28 A G 9: 48,985,506 D9G possibly damaging Het
Uty A G Y: 1,245,440 V35A probably benign Het
Vmn2r56 A G 7: 12,694,027 S771P probably benign Het
Wars2 C T 3: 99,216,861 A346V probably damaging Het
Zfp142 G T 1: 74,572,088 N849K probably benign Het
Zfp180 A T 7: 24,101,523 N66I probably benign Het
Other mutations in Palm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Palm APN 10 79816787 splice site probably benign
IGL03080:Palm APN 10 79819117 missense probably damaging 1.00
IGL03143:Palm APN 10 79816783 splice site probably benign
R0681:Palm UTSW 10 79819493 missense probably benign 0.35
R1476:Palm UTSW 10 79815187 missense possibly damaging 0.50
R3439:Palm UTSW 10 79816784 splice site probably benign
R4327:Palm UTSW 10 79807686 missense probably benign 0.31
R4328:Palm UTSW 10 79807686 missense probably benign 0.31
R4329:Palm UTSW 10 79807686 missense probably benign 0.31
R6586:Palm UTSW 10 79809531 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTTGAACCCTTGTCATCCAGAGCTATG -3'
(R):5'- GGCTGAACCTGCCTCTAGATTTCAC -3'

Sequencing Primer
(F):5'- CTTGTCATCCAGAGCTATGGAAGG -3'
(R):5'- AGATTTCACCTCAGTGCTCAG -3'
Posted On2014-04-13