Incidental Mutation 'R1534:Sez6'
ID166836
Institutional Source Beutler Lab
Gene Symbol Sez6
Ensembl Gene ENSMUSG00000000632
Gene Nameseizure related gene 6
SynonymsD11Bhm177e, sez-6
MMRRC Submission 039573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1534 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77930800-77979048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77963045 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 347 (Y347C)
Ref Sequence ENSEMBL: ENSMUSP00000091532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]
Predicted Effect probably damaging
Transcript: ENSMUST00000000646
AA Change: Y347C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: Y347C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 910 932 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093995
AA Change: Y347C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: Y347C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142542
Predicted Effect unknown
Transcript: ENSMUST00000151982
AA Change: Y180C
SMART Domains Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632
AA Change: Y180C

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
CUB 75 184 9.36e-2 SMART
CCP 188 243 1.23e-10 SMART
CUB 247 358 8.08e-29 SMART
low complexity region 379 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155087
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,530,429 noncoding transcript Het
Adcy10 T C 1: 165,518,312 I310T probably damaging Het
Adcy5 T C 16: 35,253,259 V469A possibly damaging Het
Agrn C T 4: 156,176,684 C652Y probably damaging Het
Ankfn1 C T 11: 89,523,151 V133M probably damaging Het
Ankrd13c A G 3: 158,001,120 T448A probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
B4galt2 T C 4: 117,877,472 H233R probably damaging Het
Bpifb5 T G 2: 154,229,499 Y249D possibly damaging Het
Brd1 T C 15: 88,689,663 I1078V possibly damaging Het
Celsr3 A G 9: 108,848,884 E3104G probably damaging Het
Cyp2c69 T A 19: 39,851,149 K343N probably benign Het
Cyp4f18 T A 8: 71,992,955 D331V probably damaging Het
D130040H23Rik T C 8: 69,302,726 V261A possibly damaging Het
Dchs1 T C 7: 105,772,040 D391G probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Fat4 T C 3: 38,890,089 F1044L probably damaging Het
Frrs1 A T 3: 116,878,408 T52S probably benign Het
Gan G A 8: 117,187,429 V189I probably benign Het
Hnf1b A G 11: 83,893,583 probably benign Het
Itgae T C 11: 73,145,605 I1123T possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lrrc18 A G 14: 33,008,521 K6E possibly damaging Het
Map2 G A 1: 66,413,180 V492I probably benign Het
Mtr A T 13: 12,235,544 probably benign Het
Ncor1 G T 11: 62,378,504 A689E possibly damaging Het
Olfr153 T A 2: 87,532,672 V213D probably damaging Het
Olfr668 G A 7: 104,925,414 L117F possibly damaging Het
Palm T G 10: 79,816,903 V42G probably damaging Het
Pcm1 G A 8: 41,287,701 V995I probably benign Het
Pfkp A G 13: 6,619,538 V215A probably damaging Het
Prkg2 T C 5: 98,994,561 Y238C probably damaging Het
Prr14 C T 7: 127,473,982 A167V probably benign Het
Ptprn A C 1: 75,257,943 probably null Het
Rexo2 A T 9: 48,468,890 I214N probably damaging Het
Rrbp1 A G 2: 143,988,313 S645P probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Satb2 A T 1: 56,948,233 C64* probably null Het
Sos2 A G 12: 69,616,955 I585T probably damaging Het
Spg11 G A 2: 122,092,325 T881M probably damaging Het
Tiam1 A T 16: 89,867,508 probably null Het
Tmem136 A G 9: 43,111,628 W126R probably damaging Het
Top1 T C 2: 160,714,232 I537T probably damaging Het
Trappc6a A G 7: 19,514,213 S33G probably benign Het
Tspan11 G C 6: 127,949,805 V239L probably benign Het
Ubr4 T C 4: 139,428,151 V2190A possibly damaging Het
Usp28 A G 9: 48,985,506 D9G possibly damaging Het
Uty A G Y: 1,245,440 V35A probably benign Het
Vmn2r56 A G 7: 12,694,027 S771P probably benign Het
Wars2 C T 3: 99,216,861 A346V probably damaging Het
Zfp142 G T 1: 74,572,088 N849K probably benign Het
Zfp180 A T 7: 24,101,523 N66I probably benign Het
Other mutations in Sez6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Sez6 APN 11 77977289 splice site probably benign
IGL01142:Sez6 APN 11 77973816 missense probably damaging 1.00
IGL02252:Sez6 APN 11 77974513 missense probably damaging 1.00
IGL02332:Sez6 APN 11 77954742 splice site probably benign
IGL02366:Sez6 APN 11 77976882 missense probably damaging 0.98
IGL02479:Sez6 APN 11 77978026 missense possibly damaging 0.84
IGL02963:Sez6 APN 11 77962949 missense possibly damaging 0.93
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0089:Sez6 UTSW 11 77974344 splice site probably benign
R0485:Sez6 UTSW 11 77953813 missense probably damaging 1.00
R0598:Sez6 UTSW 11 77977821 missense possibly damaging 0.88
R0729:Sez6 UTSW 11 77976585 missense probably benign 0.01
R1117:Sez6 UTSW 11 77974514 missense probably damaging 1.00
R1199:Sez6 UTSW 11 77953885 missense probably benign
R1835:Sez6 UTSW 11 77953503 missense probably benign
R1840:Sez6 UTSW 11 77953717 missense possibly damaging 0.79
R1929:Sez6 UTSW 11 77972932 missense probably damaging 1.00
R1970:Sez6 UTSW 11 77954068 critical splice donor site probably null
R3156:Sez6 UTSW 11 77953779 missense possibly damaging 0.63
R3930:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R3931:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R4894:Sez6 UTSW 11 77975260 missense probably damaging 1.00
R4904:Sez6 UTSW 11 77975254 missense probably damaging 1.00
R5026:Sez6 UTSW 11 77968989 missense probably damaging 1.00
R5040:Sez6 UTSW 11 77969089 critical splice donor site probably null
R5057:Sez6 UTSW 11 77973153 missense probably damaging 1.00
R5093:Sez6 UTSW 11 77976562 missense possibly damaging 0.88
R5640:Sez6 UTSW 11 77973759 intron probably benign
R6013:Sez6 UTSW 11 77973797 missense probably damaging 1.00
R6126:Sez6 UTSW 11 77973804 missense probably damaging 1.00
R6153:Sez6 UTSW 11 77977822 missense probably damaging 0.99
R6279:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6300:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6475:Sez6 UTSW 11 77973844
R6722:Sez6 UTSW 11 77953702 missense probably damaging 1.00
R6897:Sez6 UTSW 11 77953559 missense probably damaging 1.00
R6910:Sez6 UTSW 11 77953869 missense possibly damaging 0.85
R7012:Sez6 UTSW 11 77977795 missense probably benign 0.04
X0013:Sez6 UTSW 11 77954780 missense probably benign 0.01
X0067:Sez6 UTSW 11 77974438 critical splice acceptor site probably null
Z1088:Sez6 UTSW 11 77973197 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTCCTGATAGCACCGCTCTGTTC -3'
(R):5'- TATGGCCCATTTGATCACGCCCTG -3'

Sequencing Primer
(F):5'- TGGAGAACATCAGCCTTCAG -3'
(R):5'- ATCCCCACTTGCCATGCG -3'
Posted On2014-04-13