Incidental Mutation 'R1534:Sos2'
ID166839
Institutional Source Beutler Lab
Gene Symbol Sos2
Ensembl Gene ENSMUSG00000034801
Gene NameSOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms
MMRRC Submission 039573-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1534 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69583762-69681852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69616955 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 585 (I585T)
Ref Sequence ENSEMBL: ENSMUSP00000138793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]
PDB Structure
ORIENTATION OF PEPTIDE FRAGMENTS FROM SOS PROTEINS BOUND TO THE N-TERMINAL SH3 DOMAIN OF GRB2 DETERMINED BY NMR SPECTROSCOPY [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000035773
AA Change: I584T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: I584T

DomainStartEndE-ValueType
Pfam:Histone 54 169 3.7e-13 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182396
AA Change: I552T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: I552T

DomainStartEndE-ValueType
Pfam:Histone 97 169 1e-9 PFAM
Pfam:RhoGEF 203 344 1.6e-12 PFAM
PH 410 514 1.54e-14 SMART
RasGEFN 562 707 5.8e-52 SMART
RasGEF 742 986 2.51e-92 SMART
low complexity region 1046 1066 N/A INTRINSIC
low complexity region 1111 1119 N/A INTRINSIC
low complexity region 1140 1159 N/A INTRINSIC
low complexity region 1167 1192 N/A INTRINSIC
low complexity region 1221 1236 N/A INTRINSIC
low complexity region 1243 1259 N/A INTRINSIC
low complexity region 1268 1276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183277
AA Change: I585T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: I585T

DomainStartEndE-ValueType
Pfam:Histone 97 169 8.9e-11 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183306
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,530,429 noncoding transcript Het
Adcy10 T C 1: 165,518,312 I310T probably damaging Het
Adcy5 T C 16: 35,253,259 V469A possibly damaging Het
Agrn C T 4: 156,176,684 C652Y probably damaging Het
Ankfn1 C T 11: 89,523,151 V133M probably damaging Het
Ankrd13c A G 3: 158,001,120 T448A probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
B4galt2 T C 4: 117,877,472 H233R probably damaging Het
Bpifb5 T G 2: 154,229,499 Y249D possibly damaging Het
Brd1 T C 15: 88,689,663 I1078V possibly damaging Het
Celsr3 A G 9: 108,848,884 E3104G probably damaging Het
Cyp2c69 T A 19: 39,851,149 K343N probably benign Het
Cyp4f18 T A 8: 71,992,955 D331V probably damaging Het
D130040H23Rik T C 8: 69,302,726 V261A possibly damaging Het
Dchs1 T C 7: 105,772,040 D391G probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Fat4 T C 3: 38,890,089 F1044L probably damaging Het
Frrs1 A T 3: 116,878,408 T52S probably benign Het
Gan G A 8: 117,187,429 V189I probably benign Het
Hnf1b A G 11: 83,893,583 probably benign Het
Itgae T C 11: 73,145,605 I1123T possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lrrc18 A G 14: 33,008,521 K6E possibly damaging Het
Map2 G A 1: 66,413,180 V492I probably benign Het
Mtr A T 13: 12,235,544 probably benign Het
Ncor1 G T 11: 62,378,504 A689E possibly damaging Het
Olfr153 T A 2: 87,532,672 V213D probably damaging Het
Olfr668 G A 7: 104,925,414 L117F possibly damaging Het
Palm T G 10: 79,816,903 V42G probably damaging Het
Pcm1 G A 8: 41,287,701 V995I probably benign Het
Pfkp A G 13: 6,619,538 V215A probably damaging Het
Prkg2 T C 5: 98,994,561 Y238C probably damaging Het
Prr14 C T 7: 127,473,982 A167V probably benign Het
Ptprn A C 1: 75,257,943 probably null Het
Rexo2 A T 9: 48,468,890 I214N probably damaging Het
Rrbp1 A G 2: 143,988,313 S645P probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Satb2 A T 1: 56,948,233 C64* probably null Het
Sez6 A G 11: 77,963,045 Y347C probably damaging Het
Spg11 G A 2: 122,092,325 T881M probably damaging Het
Tiam1 A T 16: 89,867,508 probably null Het
Tmem136 A G 9: 43,111,628 W126R probably damaging Het
Top1 T C 2: 160,714,232 I537T probably damaging Het
Trappc6a A G 7: 19,514,213 S33G probably benign Het
Tspan11 G C 6: 127,949,805 V239L probably benign Het
Ubr4 T C 4: 139,428,151 V2190A possibly damaging Het
Usp28 A G 9: 48,985,506 D9G possibly damaging Het
Uty A G Y: 1,245,440 V35A probably benign Het
Vmn2r56 A G 7: 12,694,027 S771P probably benign Het
Wars2 C T 3: 99,216,861 A346V probably damaging Het
Zfp142 G T 1: 74,572,088 N849K probably benign Het
Zfp180 A T 7: 24,101,523 N66I probably benign Het
Other mutations in Sos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Sos2 APN 12 69616849 splice site probably benign
IGL01348:Sos2 APN 12 69618092 missense probably damaging 0.99
IGL01360:Sos2 APN 12 69590800 missense probably benign 0.00
IGL01586:Sos2 APN 12 69607398 missense probably damaging 1.00
IGL01721:Sos2 APN 12 69603867 missense probably damaging 0.99
IGL02024:Sos2 APN 12 69618048 splice site probably benign
IGL02347:Sos2 APN 12 69596746 missense probably benign
IGL02419:Sos2 APN 12 69616990 missense probably benign
IGL02684:Sos2 APN 12 69596666 missense probably damaging 1.00
IGL02719:Sos2 APN 12 69617184 missense probably benign 0.00
IGL03099:Sos2 APN 12 69616359 missense probably damaging 1.00
PIT4131001:Sos2 UTSW 12 69618077 missense probably benign
R0038:Sos2 UTSW 12 69596693 missense probably damaging 1.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0326:Sos2 UTSW 12 69635685 missense probably damaging 1.00
R1386:Sos2 UTSW 12 69614658 missense probably damaging 1.00
R1472:Sos2 UTSW 12 69585316 unclassified probably null
R1861:Sos2 UTSW 12 69617363 missense probably damaging 1.00
R1934:Sos2 UTSW 12 69648541 missense probably damaging 0.99
R1964:Sos2 UTSW 12 69616862 missense possibly damaging 0.51
R2402:Sos2 UTSW 12 69596799 missense possibly damaging 0.95
R2516:Sos2 UTSW 12 69650659 missense probably damaging 0.99
R2571:Sos2 UTSW 12 69635718 missense possibly damaging 0.95
R3423:Sos2 UTSW 12 69603553 missense probably damaging 1.00
R4435:Sos2 UTSW 12 69614699 missense possibly damaging 0.79
R4508:Sos2 UTSW 12 69635661 nonsense probably null
R4595:Sos2 UTSW 12 69616889 missense probably damaging 1.00
R4606:Sos2 UTSW 12 69614606 intron probably benign
R4691:Sos2 UTSW 12 69616328 missense probably damaging 1.00
R4716:Sos2 UTSW 12 69607371 missense probably benign 0.04
R4863:Sos2 UTSW 12 69640154 missense probably benign 0.04
R5179:Sos2 UTSW 12 69650728 nonsense probably null
R5319:Sos2 UTSW 12 69627284 missense probably benign 0.22
R5694:Sos2 UTSW 12 69590915 missense probably damaging 0.96
R5877:Sos2 UTSW 12 69596795 missense probably damaging 1.00
R6363:Sos2 UTSW 12 69632111 missense probably benign 0.00
R6465:Sos2 UTSW 12 69596775 missense probably benign 0.01
R6817:Sos2 UTSW 12 69618161 missense probably benign 0.32
R6822:Sos2 UTSW 12 69650649 missense probably damaging 1.00
R7015:Sos2 UTSW 12 69585235 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CCAACTCTGAAGTGTCCTTAGCCG -3'
(R):5'- ACGCCTGTGAGTACAGACATGC -3'

Sequencing Primer
(F):5'- CCTTAGCCGTTGGGTGC -3'
(R):5'- CCTGTGAGTACAGACATGCTTTTG -3'
Posted On2014-04-13