Incidental Mutation 'R1534:Brd1'
ID166844
Institutional Source Beutler Lab
Gene Symbol Brd1
Ensembl Gene ENSMUSG00000022387
Gene Namebromodomain containing 1
Synonyms1110059H06Rik
MMRRC Submission 039573-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1534 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location88687034-88734233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88689663 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1078 (I1078V)
Ref Sequence ENSEMBL: ENSMUSP00000105007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109380] [ENSMUST00000109381]
Predicted Effect probably benign
Transcript: ENSMUST00000109380
AA Change: I947V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105006
Gene: ENSMUSG00000022387
AA Change: I947V

DomainStartEndE-ValueType
Pfam:EPL1 46 196 3.3e-38 PFAM
PHD 216 262 3.17e-7 SMART
PHD 326 389 5.16e-7 SMART
low complexity region 415 436 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 532 551 N/A INTRINSIC
BROMO 560 668 8.59e-39 SMART
coiled coil region 704 726 N/A INTRINSIC
low complexity region 836 869 N/A INTRINSIC
PWWP 927 1010 2.25e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109381
AA Change: I1078V

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105007
Gene: ENSMUSG00000022387
AA Change: I1078V

DomainStartEndE-ValueType
Pfam:EPL1 47 196 3.9e-37 PFAM
PHD 216 262 3.17e-7 SMART
PHD 326 389 5.16e-7 SMART
low complexity region 415 436 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 532 551 N/A INTRINSIC
BROMO 560 668 8.59e-39 SMART
coiled coil region 704 726 N/A INTRINSIC
low complexity region 857 876 N/A INTRINSIC
low complexity region 887 898 N/A INTRINSIC
low complexity region 967 1000 N/A INTRINSIC
PWWP 1058 1141 2.25e-39 SMART
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that localizes to the nucleus and can interact with DNA and histone tails. The encoded protein is a component of the MOZ/MORF acetyltransferase complex and can stimulate acetylation of histones H3 and H4, thereby potentially playing a role in gene activation. Variation in this gene is associated with schozophrenia and bipolar disorder in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal letahlity associated with severe growth retardation, abnormal lens, anemia, and impaired fetal hematopoiesis and erythropoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,530,429 noncoding transcript Het
Adcy10 T C 1: 165,518,312 I310T probably damaging Het
Adcy5 T C 16: 35,253,259 V469A possibly damaging Het
Agrn C T 4: 156,176,684 C652Y probably damaging Het
Ankfn1 C T 11: 89,523,151 V133M probably damaging Het
Ankrd13c A G 3: 158,001,120 T448A probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
B4galt2 T C 4: 117,877,472 H233R probably damaging Het
Bpifb5 T G 2: 154,229,499 Y249D possibly damaging Het
Celsr3 A G 9: 108,848,884 E3104G probably damaging Het
Cyp2c69 T A 19: 39,851,149 K343N probably benign Het
Cyp4f18 T A 8: 71,992,955 D331V probably damaging Het
D130040H23Rik T C 8: 69,302,726 V261A possibly damaging Het
Dchs1 T C 7: 105,772,040 D391G probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Fat4 T C 3: 38,890,089 F1044L probably damaging Het
Frrs1 A T 3: 116,878,408 T52S probably benign Het
Gan G A 8: 117,187,429 V189I probably benign Het
Hnf1b A G 11: 83,893,583 probably benign Het
Itgae T C 11: 73,145,605 I1123T possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lrrc18 A G 14: 33,008,521 K6E possibly damaging Het
Map2 G A 1: 66,413,180 V492I probably benign Het
Mtr A T 13: 12,235,544 probably benign Het
Ncor1 G T 11: 62,378,504 A689E possibly damaging Het
Olfr153 T A 2: 87,532,672 V213D probably damaging Het
Olfr668 G A 7: 104,925,414 L117F possibly damaging Het
Palm T G 10: 79,816,903 V42G probably damaging Het
Pcm1 G A 8: 41,287,701 V995I probably benign Het
Pfkp A G 13: 6,619,538 V215A probably damaging Het
Prkg2 T C 5: 98,994,561 Y238C probably damaging Het
Prr14 C T 7: 127,473,982 A167V probably benign Het
Ptprn A C 1: 75,257,943 probably null Het
Rexo2 A T 9: 48,468,890 I214N probably damaging Het
Rrbp1 A G 2: 143,988,313 S645P probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Satb2 A T 1: 56,948,233 C64* probably null Het
Sez6 A G 11: 77,963,045 Y347C probably damaging Het
Sos2 A G 12: 69,616,955 I585T probably damaging Het
Spg11 G A 2: 122,092,325 T881M probably damaging Het
Tiam1 A T 16: 89,867,508 probably null Het
Tmem136 A G 9: 43,111,628 W126R probably damaging Het
Top1 T C 2: 160,714,232 I537T probably damaging Het
Trappc6a A G 7: 19,514,213 S33G probably benign Het
Tspan11 G C 6: 127,949,805 V239L probably benign Het
Ubr4 T C 4: 139,428,151 V2190A possibly damaging Het
Usp28 A G 9: 48,985,506 D9G possibly damaging Het
Uty A G Y: 1,245,440 V35A probably benign Het
Vmn2r56 A G 7: 12,694,027 S771P probably benign Het
Wars2 C T 3: 99,216,861 A346V probably damaging Het
Zfp142 G T 1: 74,572,088 N849K probably benign Het
Zfp180 A T 7: 24,101,523 N66I probably benign Het
Other mutations in Brd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Brd1 APN 15 88730158 missense probably benign 0.38
IGL00924:Brd1 APN 15 88729409 missense possibly damaging 0.80
IGL01626:Brd1 APN 15 88700887 missense probably damaging 1.00
IGL02569:Brd1 APN 15 88713929 missense probably damaging 1.00
IGL02646:Brd1 APN 15 88700877 missense probably damaging 1.00
IGL03130:Brd1 APN 15 88688374 missense probably benign
IGL03343:Brd1 APN 15 88707251 missense possibly damaging 0.89
spry UTSW 15 88688355 missense possibly damaging 0.47
R0089:Brd1 UTSW 15 88701198 missense probably benign 0.06
R0112:Brd1 UTSW 15 88730383 missense probably benign
R0165:Brd1 UTSW 15 88729777 missense probably damaging 0.99
R0965:Brd1 UTSW 15 88717028 missense probably damaging 1.00
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R2245:Brd1 UTSW 15 88689860 critical splice donor site probably null
R3611:Brd1 UTSW 15 88700944 missense probably benign
R3751:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3752:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3753:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3801:Brd1 UTSW 15 88717040 missense probably damaging 1.00
R4956:Brd1 UTSW 15 88730113 missense probably damaging 1.00
R5382:Brd1 UTSW 15 88729564 missense probably damaging 1.00
R5546:Brd1 UTSW 15 88701122 missense probably benign 0.00
R5659:Brd1 UTSW 15 88713381 missense probably benign 0.14
R5730:Brd1 UTSW 15 88717045 missense probably benign 0.05
R5773:Brd1 UTSW 15 88689549 missense probably benign 0.14
R6224:Brd1 UTSW 15 88688355 missense possibly damaging 0.47
R6371:Brd1 UTSW 15 88713998 missense probably benign
R7096:Brd1 UTSW 15 88713935 missense not run
Predicted Primers PCR Primer
(F):5'- TGTCATTAGGCAGCAGCAGACAAG -3'
(R):5'- GGGCCAGAGCAACATGTGGATTTC -3'

Sequencing Primer
(F):5'- TTACTCAGCATGGGTCAAGC -3'
(R):5'- GAGCAACATGTGGATTTCCACTG -3'
Posted On2014-04-13