Incidental Mutation 'R1521:Arhgef10l'
ID166968
Institutional Source Beutler Lab
Gene Symbol Arhgef10l
Ensembl Gene ENSMUSG00000040964
Gene NameRho guanine nucleotide exchange factor (GEF) 10-like
Synonyms2810441C07Rik
MMRRC Submission 040870-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R1521 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location140514485-140666012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140515438 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1088 (D1088G)
Ref Sequence ENSEMBL: ENSMUSP00000095431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039204] [ENSMUST00000069623] [ENSMUST00000097820] [ENSMUST00000105797] [ENSMUST00000105798] [ENSMUST00000105799]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039204
AA Change: D1127G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040531
Gene: ENSMUSG00000040964
AA Change: D1127G

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 318 500 1.95e-52 SMART
Blast:PH 535 748 3e-82 BLAST
low complexity region 821 833 N/A INTRINSIC
low complexity region 864 876 N/A INTRINSIC
Blast:WD40 1217 1270 8e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000069623
AA Change: D1093G

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000066249
Gene: ENSMUSG00000040964
AA Change: D1093G

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 279 461 1.95e-52 SMART
Blast:PH 496 714 5e-80 BLAST
low complexity region 787 799 N/A INTRINSIC
low complexity region 830 842 N/A INTRINSIC
Blast:WD40 1183 1236 7e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000097820
AA Change: D1088G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095431
Gene: ENSMUSG00000040964
AA Change: D1088G

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 279 461 1.95e-52 SMART
Blast:PH 496 709 3e-82 BLAST
low complexity region 782 794 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
Blast:WD40 1178 1231 6e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000105797
AA Change: D840G

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101423
Gene: ENSMUSG00000040964
AA Change: D840G

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
Pfam:RhoGEF 101 183 7.1e-15 PFAM
low complexity region 195 213 N/A INTRINSIC
Blast:PH 248 461 7e-83 BLAST
low complexity region 534 546 N/A INTRINSIC
low complexity region 577 589 N/A INTRINSIC
Blast:WD40 618 656 6e-15 BLAST
Blast:WD40 930 983 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105798
AA Change: D892G

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101424
Gene: ENSMUSG00000040964
AA Change: D892G

DomainStartEndE-ValueType
RhoGEF 78 260 1.95e-52 SMART
Blast:PH 295 513 8e-81 BLAST
low complexity region 586 598 N/A INTRINSIC
low complexity region 629 641 N/A INTRINSIC
Blast:WD40 982 1035 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105799
AA Change: D1132G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101425
Gene: ENSMUSG00000040964
AA Change: D1132G

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 318 500 1.95e-52 SMART
Blast:PH 535 753 5e-80 BLAST
low complexity region 826 838 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Blast:WD40 1222 1275 8e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138493
SMART Domains Protein: ENSMUSP00000119471
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
Pfam:RhoGEF 1 46 3.1e-11 PFAM
Blast:PH 81 294 3e-86 BLAST
low complexity region 367 379 N/A INTRINSIC
Blast:WD40 387 446 8e-6 BLAST
Blast:WD40 451 489 3e-15 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the RhoGEF subfamily of RhoGTPases. Members of this subfamily are activated by specific guanine nucleotide exchange factors (GEFs) and are involved in signal transduction. The encoded protein shows cytosolic distribution. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,987,235 L104P possibly damaging Het
Adgrf5 T C 17: 43,430,552 V360A probably benign Het
Ahnak G A 19: 9,004,728 M1125I probably benign Het
Akap12 T C 10: 4,354,804 V538A probably benign Het
Atp7b A T 8: 22,027,673 L268Q probably damaging Het
Atxn2 A C 5: 121,779,591 N516T probably damaging Het
Cacna1h T C 17: 25,397,354 M184V possibly damaging Het
Cacnb2 G T 2: 14,614,352 R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 E96G probably damaging Het
Ccdc78 G T 17: 25,788,781 R264L probably damaging Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Cog7 C T 7: 121,930,574 D615N possibly damaging Het
Crtc2 T C 3: 90,257,383 V115A probably benign Het
Crybg1 A G 10: 43,998,416 S899P probably damaging Het
Ctdnep1 T A 11: 69,988,635 V128E probably damaging Het
Ctnna3 A G 10: 64,959,842 K780E probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dazap2 T A 15: 100,618,065 Y91* probably null Het
Dcdc5 T C 2: 106,351,669 noncoding transcript Het
Dppa1 T A 11: 46,610,473 R74S possibly damaging Het
Elovl1 A T 4: 118,432,000 T241S probably benign Het
Eya1 G T 1: 14,274,550 Q86K probably damaging Het
Fam71a T A 1: 191,164,022 R141S probably benign Het
Fancm A T 12: 65,121,704 M1614L probably benign Het
Fcgbp C T 7: 28,075,160 T53I probably benign Het
Fpr3 T A 17: 17,971,015 W183R probably damaging Het
Galnt13 G A 2: 54,854,645 V119I probably benign Het
Gcfc2 T C 6: 81,923,812 S36P probably benign Het
Gdap2 T A 3: 100,194,615 D412E possibly damaging Het
Gm10184 T A 17: 89,910,306 N4I possibly damaging Het
Gm12258 T C 11: 58,859,555 C41R probably damaging Het
Grrp1 T C 4: 134,251,350 *272W probably null Het
Hipk1 T G 3: 103,777,782 E172D probably benign Het
Hmgcs1 T G 13: 119,703,591 L326R probably benign Het
Hs6st1 C A 1: 36,068,886 R77S probably damaging Het
Ifit3 A T 19: 34,587,173 N40Y probably damaging Het
Il1a T A 2: 129,304,741 Q144L possibly damaging Het
Itga7 A G 10: 128,957,811 E1128G possibly damaging Het
Itih2 T C 2: 10,106,747 D460G probably damaging Het
Ivns1abp G A 1: 151,351,558 C39Y probably damaging Het
Kif22 G T 7: 127,027,839 A646E probably damaging Het
Klhl29 T C 12: 5,091,307 Y559C probably damaging Het
Klhl7 T A 5: 24,149,110 probably null Het
Klhl9 A G 4: 88,721,993 S4P probably benign Het
Klk10 A G 7: 43,782,880 Q79R probably benign Het
Klk6 T C 7: 43,829,275 probably null Het
Lamc2 C T 1: 153,166,263 E42K probably benign Het
Lingo3 T C 10: 80,835,721 D125G probably benign Het
Map1b T C 13: 99,432,739 N1158S unknown Het
Masp1 T A 16: 23,494,637 N183Y probably damaging Het
Mdga2 A G 12: 66,568,926 Y636H probably benign Het
Micalcl T A 7: 112,381,610 S264T probably damaging Het
Mif A G 10: 75,859,541 V95A possibly damaging Het
Mmp17 G A 5: 129,595,088 probably null Het
Mmp23 T C 4: 155,650,717 R390G possibly damaging Het
Ncoa6 A C 2: 155,415,222 S800R possibly damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nr2e3 A T 9: 59,949,205 S67R probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr1256 G A 2: 89,835,172 R258* probably null Het
Olfr172 C T 16: 58,760,853 E108K probably damaging Het
Olfr591 T A 7: 103,173,451 Y62F probably benign Het
Olfr845 C T 9: 19,338,652 S64F probably benign Het
Olfr872 A C 9: 20,260,432 Q197H possibly damaging Het
Olfr916 T G 9: 38,657,718 I225L probably damaging Het
Olfr958 A T 9: 39,550,784 V29E possibly damaging Het
Otog A T 7: 46,259,264 H562L possibly damaging Het
Pcdh15 T C 10: 74,594,191 V1250A probably damaging Het
Pde1c A G 6: 56,173,607 V309A possibly damaging Het
Pfkfb4 A C 9: 109,007,305 T134P probably damaging Het
Phc3 G T 3: 30,936,575 Q498K possibly damaging Het
Phlpp1 T C 1: 106,392,319 V1348A probably damaging Het
Pik3ap1 T C 19: 41,321,558 D441G probably damaging Het
Pkd1l2 T C 8: 117,065,500 probably null Het
Pla2g4a T C 1: 149,857,686 probably null Het
Pola2 A T 19: 5,948,406 I376N probably damaging Het
Pold2 T A 11: 5,876,833 N34Y probably damaging Het
Ppp2r5c T C 12: 110,554,886 L281P probably damaging Het
Prss46 A G 9: 110,849,635 I29V probably benign Het
Ranbp6 A T 19: 29,811,446 V502E probably benign Het
Rdh14 T C 12: 10,394,613 F155L probably damaging Het
Rnaseh2a A T 8: 84,965,858 probably null Het
Rpp30 A G 19: 36,094,385 T118A possibly damaging Het
Rragd T C 4: 32,996,005 F117L probably damaging Het
S100a2 T A 3: 90,591,292 probably null Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Sh3tc2 A G 18: 62,008,488 E1080G probably damaging Het
Slc26a9 A G 1: 131,750,677 K27R probably damaging Het
Spata17 T A 1: 187,193,994 K46N probably damaging Het
St14 A C 9: 31,108,215 D103E probably benign Het
St6galnac2 T A 11: 116,684,347 Q222L possibly damaging Het
Tdrd9 T C 12: 112,036,410 V831A probably damaging Het
Tert A G 13: 73,642,056 E843G probably damaging Het
Tex21 A G 12: 76,204,270 V464A probably benign Het
Tmem232 T A 17: 65,484,501 H124L probably damaging Het
Tmem5 A G 10: 122,090,479 W243R probably damaging Het
Tnfrsf19 T G 14: 61,005,106 S110R probably damaging Het
Tnnt3 A T 7: 142,515,825 K272* probably null Het
Tnxb T C 17: 34,711,503 L2054P probably damaging Het
Trcg1 A C 9: 57,242,465 D440A probably benign Het
Trpm3 A G 19: 22,901,221 E504G probably damaging Het
Trpm5 C T 7: 143,082,889 R437H probably benign Het
Ttn T C 2: 76,741,167 R18134G probably damaging Het
Uchl5 A C 1: 143,798,422 M64L possibly damaging Het
Urb1 G A 16: 90,753,863 R2034W probably damaging Het
Usp44 T A 10: 93,847,186 C452* probably null Het
Uvssa G A 5: 33,413,934 A641T probably damaging Het
Vmn1r204 T A 13: 22,557,078 I293N probably benign Het
Vmn2r84 A T 10: 130,389,268 C458S probably benign Het
Vmn2r85 T G 10: 130,425,919 H183P probably damaging Het
Vps13d G T 4: 145,105,861 T2825K probably benign Het
Zc3hc1 T A 6: 30,376,025 I179F probably benign Het
Zfp112 A G 7: 24,125,785 N393D probably damaging Het
Zfp558 A G 9: 18,456,563 S310P possibly damaging Het
Zfp560 A C 9: 20,348,775 probably null Het
Zfp668 C T 7: 127,867,080 E311K probably benign Het
Zfp763 T A 17: 33,033,302 M1L probably benign Het
Zfp947 A T 17: 22,145,832 M287K probably benign Het
Other mutations in Arhgef10l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Arhgef10l APN 4 140570338 missense probably damaging 0.98
IGL01732:Arhgef10l APN 4 140580415 missense probably damaging 0.99
IGL01988:Arhgef10l APN 4 140578361 splice site probably benign
IGL02031:Arhgef10l APN 4 140575345 missense probably damaging 1.00
IGL02253:Arhgef10l APN 4 140544284 nonsense probably null
IGL02445:Arhgef10l APN 4 140547007 missense probably benign 0.19
IGL02619:Arhgef10l APN 4 140594193 missense probably benign 0.07
IGL02798:Arhgef10l APN 4 140565130 critical splice donor site probably null
IGL03064:Arhgef10l APN 4 140579279 missense probably damaging 1.00
IGL03178:Arhgef10l APN 4 140544428 missense possibly damaging 0.92
IGL03236:Arhgef10l APN 4 140611360 missense probably damaging 1.00
IGL03352:Arhgef10l APN 4 140583931 start codon destroyed probably null 0.99
R0057:Arhgef10l UTSW 4 140611218 splice site probably benign
R0062:Arhgef10l UTSW 4 140552532 missense probably damaging 1.00
R0109:Arhgef10l UTSW 4 140578294 missense probably benign 0.02
R0109:Arhgef10l UTSW 4 140578294 missense probably benign 0.02
R0114:Arhgef10l UTSW 4 140583883 missense probably benign 0.17
R0334:Arhgef10l UTSW 4 140583926 nonsense probably null
R0742:Arhgef10l UTSW 4 140536845 missense probably damaging 1.00
R1017:Arhgef10l UTSW 4 140515306 missense probably damaging 0.99
R1166:Arhgef10l UTSW 4 140575270 unclassified probably benign
R1397:Arhgef10l UTSW 4 140544443 missense probably damaging 0.98
R1707:Arhgef10l UTSW 4 140564289 missense probably damaging 1.00
R1793:Arhgef10l UTSW 4 140515373 missense probably damaging 0.97
R2018:Arhgef10l UTSW 4 140544384 missense probably damaging 1.00
R2093:Arhgef10l UTSW 4 140570290 missense possibly damaging 0.57
R2098:Arhgef10l UTSW 4 140579432 missense probably damaging 1.00
R2310:Arhgef10l UTSW 4 140593118 missense probably damaging 1.00
R2879:Arhgef10l UTSW 4 140515287 missense probably benign 0.09
R2883:Arhgef10l UTSW 4 140516802 missense probably benign 0.02
R3732:Arhgef10l UTSW 4 140581619 small deletion probably benign
R3732:Arhgef10l UTSW 4 140581619 small deletion probably benign
R3861:Arhgef10l UTSW 4 140515487 missense possibly damaging 0.94
R4049:Arhgef10l UTSW 4 140515451 missense probably benign 0.05
R4322:Arhgef10l UTSW 4 140542726 missense probably benign 0.07
R4707:Arhgef10l UTSW 4 140536883 missense possibly damaging 0.63
R5395:Arhgef10l UTSW 4 140570290 missense probably benign 0.16
R5720:Arhgef10l UTSW 4 140581619 small deletion probably benign
R6066:Arhgef10l UTSW 4 140577080 missense probably damaging 1.00
R6190:Arhgef10l UTSW 4 140542762 missense possibly damaging 0.90
R6464:Arhgef10l UTSW 4 140586815 missense probably benign 0.05
R6476:Arhgef10l UTSW 4 140611382 missense probably damaging 1.00
R6478:Arhgef10l UTSW 4 140542757 missense possibly damaging 0.91
R6483:Arhgef10l UTSW 4 140616915 missense probably damaging 0.99
R6631:Arhgef10l UTSW 4 140517747 intron probably benign
R6721:Arhgef10l UTSW 4 140570344 missense probably damaging 1.00
R6890:Arhgef10l UTSW 4 140544419 missense probably damaging 1.00
R7098:Arhgef10l UTSW 4 140580911 missense not run
R7100:Arhgef10l UTSW 4 140516815 missense not run
R7117:Arhgef10l UTSW 4 140564186 critical splice donor site unknown
Z1088:Arhgef10l UTSW 4 140581735 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGTCCACCAGAGATGATAGCCACAG -3'
(R):5'- CTTGGAGATGGAGAATGCCTCCAC -3'

Sequencing Primer
(F):5'- ACAGAGCAGATCTCCTTGCG -3'
(R):5'- GATCCTATAGCCTCTGATAAGGTGC -3'
Posted On2014-04-13