Incidental Mutation 'R1521:Atxn2'
ID166975
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Nameataxin 2
Synonyms9630045M23Rik, ATX2, Sca2
MMRRC Submission 040870-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R1521 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121711337-121816493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 121779591 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 516 (N516T)
Ref Sequence ENSEMBL: ENSMUSP00000056715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000161064] [ENSMUST00000162327] [ENSMUST00000225761]
Predicted Effect probably damaging
Transcript: ENSMUST00000051950
AA Change: N516T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605
AA Change: N516T

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160821
AA Change: N117T
SMART Domains Protein: ENSMUSP00000125647
Gene: ENSMUSG00000042605
AA Change: N117T

DomainStartEndE-ValueType
Pfam:LsmAD 1 47 3.6e-11 PFAM
low complexity region 217 237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161064
AA Change: N207T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605
AA Change: N207T

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162327
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200499
Predicted Effect probably damaging
Transcript: ENSMUST00000225761
AA Change: N366T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,987,235 L104P possibly damaging Het
Adgrf5 T C 17: 43,430,552 V360A probably benign Het
Ahnak G A 19: 9,004,728 M1125I probably benign Het
Akap12 T C 10: 4,354,804 V538A probably benign Het
Arhgef10l T C 4: 140,515,438 D1088G possibly damaging Het
Atp7b A T 8: 22,027,673 L268Q probably damaging Het
Cacna1h T C 17: 25,397,354 M184V possibly damaging Het
Cacnb2 G T 2: 14,614,352 R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 E96G probably damaging Het
Ccdc78 G T 17: 25,788,781 R264L probably damaging Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Cog7 C T 7: 121,930,574 D615N possibly damaging Het
Crtc2 T C 3: 90,257,383 V115A probably benign Het
Crybg1 A G 10: 43,998,416 S899P probably damaging Het
Ctdnep1 T A 11: 69,988,635 V128E probably damaging Het
Ctnna3 A G 10: 64,959,842 K780E probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dazap2 T A 15: 100,618,065 Y91* probably null Het
Dcdc5 T C 2: 106,351,669 noncoding transcript Het
Dppa1 T A 11: 46,610,473 R74S possibly damaging Het
Elovl1 A T 4: 118,432,000 T241S probably benign Het
Eya1 G T 1: 14,274,550 Q86K probably damaging Het
Fam71a T A 1: 191,164,022 R141S probably benign Het
Fancm A T 12: 65,121,704 M1614L probably benign Het
Fcgbp C T 7: 28,075,160 T53I probably benign Het
Fpr3 T A 17: 17,971,015 W183R probably damaging Het
Galnt13 G A 2: 54,854,645 V119I probably benign Het
Gcfc2 T C 6: 81,923,812 S36P probably benign Het
Gdap2 T A 3: 100,194,615 D412E possibly damaging Het
Gm10184 T A 17: 89,910,306 N4I possibly damaging Het
Gm12258 T C 11: 58,859,555 C41R probably damaging Het
Grrp1 T C 4: 134,251,350 *272W probably null Het
Hipk1 T G 3: 103,777,782 E172D probably benign Het
Hmgcs1 T G 13: 119,703,591 L326R probably benign Het
Hs6st1 C A 1: 36,068,886 R77S probably damaging Het
Ifit3 A T 19: 34,587,173 N40Y probably damaging Het
Il1a T A 2: 129,304,741 Q144L possibly damaging Het
Itga7 A G 10: 128,957,811 E1128G possibly damaging Het
Itih2 T C 2: 10,106,747 D460G probably damaging Het
Ivns1abp G A 1: 151,351,558 C39Y probably damaging Het
Kif22 G T 7: 127,027,839 A646E probably damaging Het
Klhl29 T C 12: 5,091,307 Y559C probably damaging Het
Klhl7 T A 5: 24,149,110 probably null Het
Klhl9 A G 4: 88,721,993 S4P probably benign Het
Klk10 A G 7: 43,782,880 Q79R probably benign Het
Klk6 T C 7: 43,829,275 probably null Het
Lamc2 C T 1: 153,166,263 E42K probably benign Het
Lingo3 T C 10: 80,835,721 D125G probably benign Het
Map1b T C 13: 99,432,739 N1158S unknown Het
Masp1 T A 16: 23,494,637 N183Y probably damaging Het
Mdga2 A G 12: 66,568,926 Y636H probably benign Het
Micalcl T A 7: 112,381,610 S264T probably damaging Het
Mif A G 10: 75,859,541 V95A possibly damaging Het
Mmp17 G A 5: 129,595,088 probably null Het
Mmp23 T C 4: 155,650,717 R390G possibly damaging Het
Ncoa6 A C 2: 155,415,222 S800R possibly damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nr2e3 A T 9: 59,949,205 S67R probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr1256 G A 2: 89,835,172 R258* probably null Het
Olfr172 C T 16: 58,760,853 E108K probably damaging Het
Olfr591 T A 7: 103,173,451 Y62F probably benign Het
Olfr845 C T 9: 19,338,652 S64F probably benign Het
Olfr872 A C 9: 20,260,432 Q197H possibly damaging Het
Olfr916 T G 9: 38,657,718 I225L probably damaging Het
Olfr958 A T 9: 39,550,784 V29E possibly damaging Het
Otog A T 7: 46,259,264 H562L possibly damaging Het
Pcdh15 T C 10: 74,594,191 V1250A probably damaging Het
Pde1c A G 6: 56,173,607 V309A possibly damaging Het
Pfkfb4 A C 9: 109,007,305 T134P probably damaging Het
Phc3 G T 3: 30,936,575 Q498K possibly damaging Het
Phlpp1 T C 1: 106,392,319 V1348A probably damaging Het
Pik3ap1 T C 19: 41,321,558 D441G probably damaging Het
Pkd1l2 T C 8: 117,065,500 probably null Het
Pla2g4a T C 1: 149,857,686 probably null Het
Pola2 A T 19: 5,948,406 I376N probably damaging Het
Pold2 T A 11: 5,876,833 N34Y probably damaging Het
Ppp2r5c T C 12: 110,554,886 L281P probably damaging Het
Prss46 A G 9: 110,849,635 I29V probably benign Het
Ranbp6 A T 19: 29,811,446 V502E probably benign Het
Rdh14 T C 12: 10,394,613 F155L probably damaging Het
Rnaseh2a A T 8: 84,965,858 probably null Het
Rpp30 A G 19: 36,094,385 T118A possibly damaging Het
Rragd T C 4: 32,996,005 F117L probably damaging Het
S100a2 T A 3: 90,591,292 probably null Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Sh3tc2 A G 18: 62,008,488 E1080G probably damaging Het
Slc26a9 A G 1: 131,750,677 K27R probably damaging Het
Spata17 T A 1: 187,193,994 K46N probably damaging Het
St14 A C 9: 31,108,215 D103E probably benign Het
St6galnac2 T A 11: 116,684,347 Q222L possibly damaging Het
Tdrd9 T C 12: 112,036,410 V831A probably damaging Het
Tert A G 13: 73,642,056 E843G probably damaging Het
Tex21 A G 12: 76,204,270 V464A probably benign Het
Tmem232 T A 17: 65,484,501 H124L probably damaging Het
Tmem5 A G 10: 122,090,479 W243R probably damaging Het
Tnfrsf19 T G 14: 61,005,106 S110R probably damaging Het
Tnnt3 A T 7: 142,515,825 K272* probably null Het
Tnxb T C 17: 34,711,503 L2054P probably damaging Het
Trcg1 A C 9: 57,242,465 D440A probably benign Het
Trpm3 A G 19: 22,901,221 E504G probably damaging Het
Trpm5 C T 7: 143,082,889 R437H probably benign Het
Ttn T C 2: 76,741,167 R18134G probably damaging Het
Uchl5 A C 1: 143,798,422 M64L possibly damaging Het
Urb1 G A 16: 90,753,863 R2034W probably damaging Het
Usp44 T A 10: 93,847,186 C452* probably null Het
Uvssa G A 5: 33,413,934 A641T probably damaging Het
Vmn1r204 T A 13: 22,557,078 I293N probably benign Het
Vmn2r84 A T 10: 130,389,268 C458S probably benign Het
Vmn2r85 T G 10: 130,425,919 H183P probably damaging Het
Vps13d G T 4: 145,105,861 T2825K probably benign Het
Zc3hc1 T A 6: 30,376,025 I179F probably benign Het
Zfp112 A G 7: 24,125,785 N393D probably damaging Het
Zfp558 A G 9: 18,456,563 S310P possibly damaging Het
Zfp560 A C 9: 20,348,775 probably null Het
Zfp668 C T 7: 127,867,080 E311K probably benign Het
Zfp763 T A 17: 33,033,302 M1L probably benign Het
Zfp947 A T 17: 22,145,832 M287K probably benign Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121795055 missense probably benign 0.00
IGL00798:Atxn2 APN 5 121795235 missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121810979 missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121797344 missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121806268 nonsense probably null
IGL02122:Atxn2 APN 5 121778030 missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121781387 missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121781336 missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121810909 missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121785235 missense probably benign 0.00
R0387:Atxn2 UTSW 5 121802143 missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121772778 missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121747421 unclassified probably null
R1305:Atxn2 UTSW 5 121749184 missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121803082 critical splice donor site probably null
R1471:Atxn2 UTSW 5 121786374 missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121802108 missense probably damaging 0.99
R1528:Atxn2 UTSW 5 121813530 missense probably damaging 1.00
R2083:Atxn2 UTSW 5 121784006 missense probably benign 0.00
R2197:Atxn2 UTSW 5 121806217 splice site probably null
R2217:Atxn2 UTSW 5 121803077 missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121803077 missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121802079 critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121802079 critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121781393 missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121785868 critical splice donor site probably null
R4604:Atxn2 UTSW 5 121781343 missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121814411 missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121749096 missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121814343 missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121795035 unclassified probably null
R5213:Atxn2 UTSW 5 121814480 unclassified probably null
R5655:Atxn2 UTSW 5 121747426 missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121813449 missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121797310 missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121810992 missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121779432 missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121811614 critical splice donor site probably null
R6659:Atxn2 UTSW 5 121777964 missense probably benign 0.10
R6864:Atxn2 UTSW 5 121779494 missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121811467 nonsense probably null
X0028:Atxn2 UTSW 5 121802083 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCAGGATGAAAGTGAGCACACC -3'
(R):5'- TGTCACCCTATACGCGCCAATG -3'

Sequencing Primer
(F):5'- TAGAGGATCTCTCATTTCCAGGGAC -3'
(R):5'- CGCCAATGACAGATACAGTGTTATAC -3'
Posted On2014-04-13