Incidental Mutation 'R1521:Pde1c'
ID166979
Institutional Source Beutler Lab
Gene Symbol Pde1c
Ensembl Gene ENSMUSG00000004347
Gene Namephosphodiesterase 1C
Synonyms
MMRRC Submission 040870-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R1521 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location56069804-56569103 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56173607 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 309 (V309A)
Ref Sequence ENSEMBL: ENSMUSP00000145508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044505] [ENSMUST00000114327] [ENSMUST00000164037] [ENSMUST00000164752] [ENSMUST00000166102] [ENSMUST00000166890] [ENSMUST00000168944] [ENSMUST00000170774] [ENSMUST00000203372]
Predicted Effect probably benign
Transcript: ENSMUST00000044505
AA Change: V249A

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046601
Gene: ENSMUSG00000004347
AA Change: V249A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 3.8e-34 PFAM
HDc 225 390 1.02e-5 SMART
Blast:HDc 402 681 1e-123 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114327
AA Change: V249A

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109966
Gene: ENSMUSG00000004347
AA Change: V249A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 4.7e-31 PFAM
HDc 225 390 1.02e-5 SMART
Blast:HDc 402 650 1e-110 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164037
AA Change: V240A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130139
Gene: ENSMUSG00000004347
AA Change: V240A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 8e-32 PFAM
HDc 216 381 1.02e-5 SMART
Blast:HDc 393 618 1e-102 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164752
AA Change: V249A

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129185
Gene: ENSMUSG00000004347
AA Change: V249A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 3e-28 PFAM
HDc 225 390 5.7e-8 SMART
Blast:HDc 402 627 1e-101 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166102
AA Change: V249A

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131350
Gene: ENSMUSG00000004347
AA Change: V249A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 3e-28 PFAM
HDc 225 390 5.7e-8 SMART
Blast:HDc 402 627 1e-101 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000166890
AA Change: V221A

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131892
Gene: ENSMUSG00000004347
AA Change: V221A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 54 114 3.5e-31 PFAM
HDc 197 362 1.02e-5 SMART
Blast:HDc 374 599 1e-102 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168944
AA Change: V249A

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128364
Gene: ENSMUSG00000004347
AA Change: V249A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 4.7e-31 PFAM
HDc 225 390 1.02e-5 SMART
Blast:HDc 402 650 1e-110 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170774
AA Change: V212A

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133170
Gene: ENSMUSG00000004347
AA Change: V212A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 45 105 3.6e-31 PFAM
HDc 188 353 1.02e-5 SMART
Blast:HDc 365 613 1e-110 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198921
Predicted Effect possibly damaging
Transcript: ENSMUST00000203372
AA Change: V309A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145508
Gene: ENSMUSG00000004347
AA Change: V309A

DomainStartEndE-ValueType
Pfam:PDEase_I_N 142 202 3.1e-31 PFAM
HDc 285 450 5.8e-8 SMART
Blast:HDc 462 741 1e-122 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203967
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the 3'5'-cyclic nucleotide phosphodiesterase family. Members of this family catalyze hydrolysis of the cyclic nucleotides, cyclic adenosine monophosphate and cyclic guanosine monophosphate, to the corresponding nucleoside 5'-monophosphates. The enzyme encoded by this gene regulates proliferation and migration of vascular smooth muscle cells, and neointimal hyperplasia. This enzyme also plays a role in pathological vascular remodeling by regulating the stability of growth factor receptors, such as PDGF-receptor-beta. [provided by RefSeq, Jul 2016]
PHENOTYPE: Olfactory sensory nerves from homozygous null mice have significantly reduced action potentials in response to odor with slower onset kinetics and a faster response termination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,987,235 L104P possibly damaging Het
Adgrf5 T C 17: 43,430,552 V360A probably benign Het
Ahnak G A 19: 9,004,728 M1125I probably benign Het
Akap12 T C 10: 4,354,804 V538A probably benign Het
Arhgef10l T C 4: 140,515,438 D1088G possibly damaging Het
Atp7b A T 8: 22,027,673 L268Q probably damaging Het
Atxn2 A C 5: 121,779,591 N516T probably damaging Het
Cacna1h T C 17: 25,397,354 M184V possibly damaging Het
Cacnb2 G T 2: 14,614,352 R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 E96G probably damaging Het
Ccdc78 G T 17: 25,788,781 R264L probably damaging Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Cog7 C T 7: 121,930,574 D615N possibly damaging Het
Crtc2 T C 3: 90,257,383 V115A probably benign Het
Crybg1 A G 10: 43,998,416 S899P probably damaging Het
Ctdnep1 T A 11: 69,988,635 V128E probably damaging Het
Ctnna3 A G 10: 64,959,842 K780E probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dazap2 T A 15: 100,618,065 Y91* probably null Het
Dcdc5 T C 2: 106,351,669 noncoding transcript Het
Dppa1 T A 11: 46,610,473 R74S possibly damaging Het
Elovl1 A T 4: 118,432,000 T241S probably benign Het
Eya1 G T 1: 14,274,550 Q86K probably damaging Het
Fam71a T A 1: 191,164,022 R141S probably benign Het
Fancm A T 12: 65,121,704 M1614L probably benign Het
Fcgbp C T 7: 28,075,160 T53I probably benign Het
Fpr3 T A 17: 17,971,015 W183R probably damaging Het
Galnt13 G A 2: 54,854,645 V119I probably benign Het
Gcfc2 T C 6: 81,923,812 S36P probably benign Het
Gdap2 T A 3: 100,194,615 D412E possibly damaging Het
Gm10184 T A 17: 89,910,306 N4I possibly damaging Het
Gm12258 T C 11: 58,859,555 C41R probably damaging Het
Grrp1 T C 4: 134,251,350 *272W probably null Het
Hipk1 T G 3: 103,777,782 E172D probably benign Het
Hmgcs1 T G 13: 119,703,591 L326R probably benign Het
Hs6st1 C A 1: 36,068,886 R77S probably damaging Het
Ifit3 A T 19: 34,587,173 N40Y probably damaging Het
Il1a T A 2: 129,304,741 Q144L possibly damaging Het
Itga7 A G 10: 128,957,811 E1128G possibly damaging Het
Itih2 T C 2: 10,106,747 D460G probably damaging Het
Ivns1abp G A 1: 151,351,558 C39Y probably damaging Het
Kif22 G T 7: 127,027,839 A646E probably damaging Het
Klhl29 T C 12: 5,091,307 Y559C probably damaging Het
Klhl7 T A 5: 24,149,110 probably null Het
Klhl9 A G 4: 88,721,993 S4P probably benign Het
Klk10 A G 7: 43,782,880 Q79R probably benign Het
Klk6 T C 7: 43,829,275 probably null Het
Lamc2 C T 1: 153,166,263 E42K probably benign Het
Lingo3 T C 10: 80,835,721 D125G probably benign Het
Map1b T C 13: 99,432,739 N1158S unknown Het
Masp1 T A 16: 23,494,637 N183Y probably damaging Het
Mdga2 A G 12: 66,568,926 Y636H probably benign Het
Micalcl T A 7: 112,381,610 S264T probably damaging Het
Mif A G 10: 75,859,541 V95A possibly damaging Het
Mmp17 G A 5: 129,595,088 probably null Het
Mmp23 T C 4: 155,650,717 R390G possibly damaging Het
Ncoa6 A C 2: 155,415,222 S800R possibly damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nr2e3 A T 9: 59,949,205 S67R probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr1256 G A 2: 89,835,172 R258* probably null Het
Olfr172 C T 16: 58,760,853 E108K probably damaging Het
Olfr591 T A 7: 103,173,451 Y62F probably benign Het
Olfr845 C T 9: 19,338,652 S64F probably benign Het
Olfr872 A C 9: 20,260,432 Q197H possibly damaging Het
Olfr916 T G 9: 38,657,718 I225L probably damaging Het
Olfr958 A T 9: 39,550,784 V29E possibly damaging Het
Otog A T 7: 46,259,264 H562L possibly damaging Het
Pcdh15 T C 10: 74,594,191 V1250A probably damaging Het
Pfkfb4 A C 9: 109,007,305 T134P probably damaging Het
Phc3 G T 3: 30,936,575 Q498K possibly damaging Het
Phlpp1 T C 1: 106,392,319 V1348A probably damaging Het
Pik3ap1 T C 19: 41,321,558 D441G probably damaging Het
Pkd1l2 T C 8: 117,065,500 probably null Het
Pla2g4a T C 1: 149,857,686 probably null Het
Pola2 A T 19: 5,948,406 I376N probably damaging Het
Pold2 T A 11: 5,876,833 N34Y probably damaging Het
Ppp2r5c T C 12: 110,554,886 L281P probably damaging Het
Prss46 A G 9: 110,849,635 I29V probably benign Het
Ranbp6 A T 19: 29,811,446 V502E probably benign Het
Rdh14 T C 12: 10,394,613 F155L probably damaging Het
Rnaseh2a A T 8: 84,965,858 probably null Het
Rpp30 A G 19: 36,094,385 T118A possibly damaging Het
Rragd T C 4: 32,996,005 F117L probably damaging Het
S100a2 T A 3: 90,591,292 probably null Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Sh3tc2 A G 18: 62,008,488 E1080G probably damaging Het
Slc26a9 A G 1: 131,750,677 K27R probably damaging Het
Spata17 T A 1: 187,193,994 K46N probably damaging Het
St14 A C 9: 31,108,215 D103E probably benign Het
St6galnac2 T A 11: 116,684,347 Q222L possibly damaging Het
Tdrd9 T C 12: 112,036,410 V831A probably damaging Het
Tert A G 13: 73,642,056 E843G probably damaging Het
Tex21 A G 12: 76,204,270 V464A probably benign Het
Tmem232 T A 17: 65,484,501 H124L probably damaging Het
Tmem5 A G 10: 122,090,479 W243R probably damaging Het
Tnfrsf19 T G 14: 61,005,106 S110R probably damaging Het
Tnnt3 A T 7: 142,515,825 K272* probably null Het
Tnxb T C 17: 34,711,503 L2054P probably damaging Het
Trcg1 A C 9: 57,242,465 D440A probably benign Het
Trpm3 A G 19: 22,901,221 E504G probably damaging Het
Trpm5 C T 7: 143,082,889 R437H probably benign Het
Ttn T C 2: 76,741,167 R18134G probably damaging Het
Uchl5 A C 1: 143,798,422 M64L possibly damaging Het
Urb1 G A 16: 90,753,863 R2034W probably damaging Het
Usp44 T A 10: 93,847,186 C452* probably null Het
Uvssa G A 5: 33,413,934 A641T probably damaging Het
Vmn1r204 T A 13: 22,557,078 I293N probably benign Het
Vmn2r84 A T 10: 130,389,268 C458S probably benign Het
Vmn2r85 T G 10: 130,425,919 H183P probably damaging Het
Vps13d G T 4: 145,105,861 T2825K probably benign Het
Zc3hc1 T A 6: 30,376,025 I179F probably benign Het
Zfp112 A G 7: 24,125,785 N393D probably damaging Het
Zfp558 A G 9: 18,456,563 S310P possibly damaging Het
Zfp560 A C 9: 20,348,775 probably null Het
Zfp668 C T 7: 127,867,080 E311K probably benign Het
Zfp763 T A 17: 33,033,302 M1L probably benign Het
Zfp947 A T 17: 22,145,832 M287K probably benign Het
Other mutations in Pde1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Pde1c APN 6 56173674 missense probably damaging 1.00
IGL02316:Pde1c APN 6 56151351 missense possibly damaging 0.77
IGL02751:Pde1c APN 6 56181688 missense probably damaging 1.00
IGL02801:Pde1c APN 6 56173666 missense probably damaging 1.00
IGL02975:Pde1c APN 6 56158936 missense probably damaging 1.00
IGL03357:Pde1c APN 6 56180093 missense probably damaging 1.00
R0523:Pde1c UTSW 6 56174941 missense probably damaging 1.00
R0717:Pde1c UTSW 6 56123012 missense probably damaging 0.98
R0973:Pde1c UTSW 6 56361815 missense probably benign 0.00
R1344:Pde1c UTSW 6 56361767 missense probably benign 0.08
R1818:Pde1c UTSW 6 56126892 nonsense probably null
R2004:Pde1c UTSW 6 56159011 missense probably damaging 1.00
R2026:Pde1c UTSW 6 56180190 missense probably damaging 1.00
R4380:Pde1c UTSW 6 56072278 missense probably null 0.02
R4729:Pde1c UTSW 6 56072209 missense probably damaging 1.00
R4847:Pde1c UTSW 6 56123034 missense possibly damaging 0.52
R4993:Pde1c UTSW 6 56150624 missense probably damaging 0.98
R5666:Pde1c UTSW 6 56126857 critical splice donor site probably null
R6005:Pde1c UTSW 6 56479202 splice site probably null
R6636:Pde1c UTSW 6 56180102 missense probably damaging 1.00
R6701:Pde1c UTSW 6 56181700 missense probably damaging 1.00
R6990:Pde1c UTSW 6 56442035 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCATAATGCTCAGGGAGCACTTCAG -3'
(R):5'- TGGGGACACTTTTCTCAGAATAAAGGC -3'

Sequencing Primer
(F):5'- TTCAGAGTGCCCAAACATCAGG -3'
(R):5'- AGGGACCTTAGTGTTTCTCACAAG -3'
Posted On2014-04-13