Incidental Mutation 'R1521:Pfkfb4'
ID167008
Institutional Source Beutler Lab
Gene Symbol Pfkfb4
Ensembl Gene ENSMUSG00000025648
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Synonyms
MMRRC Submission 040870-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1521 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108991778-109032228 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 109007305 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 134 (T134P)
Ref Sequence ENSEMBL: ENSMUSP00000142992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]
Predicted Effect probably damaging
Transcript: ENSMUST00000051873
AA Change: T118P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648
AA Change: T118P

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 3.2e-105 PFAM
Pfam:AAA_33 41 199 2.3e-8 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196249
Predicted Effect probably damaging
Transcript: ENSMUST00000198140
AA Change: T134P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648
AA Change: T134P

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.9e-105 PFAM
Pfam:AAA_33 41 198 8.5e-10 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199184
Predicted Effect probably damaging
Transcript: ENSMUST00000199591
AA Change: T134P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648
AA Change: T134P

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.4e-105 PFAM
Pfam:AAA_33 41 198 6.6e-10 PFAM
PGAM 251 396 4.98e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200229
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,987,235 L104P possibly damaging Het
Adgrf5 T C 17: 43,430,552 V360A probably benign Het
Ahnak G A 19: 9,004,728 M1125I probably benign Het
Akap12 T C 10: 4,354,804 V538A probably benign Het
Arhgef10l T C 4: 140,515,438 D1088G possibly damaging Het
Atp7b A T 8: 22,027,673 L268Q probably damaging Het
Atxn2 A C 5: 121,779,591 N516T probably damaging Het
Cacna1h T C 17: 25,397,354 M184V possibly damaging Het
Cacnb2 G T 2: 14,614,352 R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 E96G probably damaging Het
Ccdc78 G T 17: 25,788,781 R264L probably damaging Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Cog7 C T 7: 121,930,574 D615N possibly damaging Het
Crtc2 T C 3: 90,257,383 V115A probably benign Het
Crybg1 A G 10: 43,998,416 S899P probably damaging Het
Ctdnep1 T A 11: 69,988,635 V128E probably damaging Het
Ctnna3 A G 10: 64,959,842 K780E probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dazap2 T A 15: 100,618,065 Y91* probably null Het
Dcdc5 T C 2: 106,351,669 noncoding transcript Het
Dppa1 T A 11: 46,610,473 R74S possibly damaging Het
Elovl1 A T 4: 118,432,000 T241S probably benign Het
Eya1 G T 1: 14,274,550 Q86K probably damaging Het
Fam71a T A 1: 191,164,022 R141S probably benign Het
Fancm A T 12: 65,121,704 M1614L probably benign Het
Fcgbp C T 7: 28,075,160 T53I probably benign Het
Fpr3 T A 17: 17,971,015 W183R probably damaging Het
Galnt13 G A 2: 54,854,645 V119I probably benign Het
Gcfc2 T C 6: 81,923,812 S36P probably benign Het
Gdap2 T A 3: 100,194,615 D412E possibly damaging Het
Gm10184 T A 17: 89,910,306 N4I possibly damaging Het
Gm12258 T C 11: 58,859,555 C41R probably damaging Het
Grrp1 T C 4: 134,251,350 *272W probably null Het
Hipk1 T G 3: 103,777,782 E172D probably benign Het
Hmgcs1 T G 13: 119,703,591 L326R probably benign Het
Hs6st1 C A 1: 36,068,886 R77S probably damaging Het
Ifit3 A T 19: 34,587,173 N40Y probably damaging Het
Il1a T A 2: 129,304,741 Q144L possibly damaging Het
Itga7 A G 10: 128,957,811 E1128G possibly damaging Het
Itih2 T C 2: 10,106,747 D460G probably damaging Het
Ivns1abp G A 1: 151,351,558 C39Y probably damaging Het
Kif22 G T 7: 127,027,839 A646E probably damaging Het
Klhl29 T C 12: 5,091,307 Y559C probably damaging Het
Klhl7 T A 5: 24,149,110 probably null Het
Klhl9 A G 4: 88,721,993 S4P probably benign Het
Klk10 A G 7: 43,782,880 Q79R probably benign Het
Klk6 T C 7: 43,829,275 probably null Het
Lamc2 C T 1: 153,166,263 E42K probably benign Het
Lingo3 T C 10: 80,835,721 D125G probably benign Het
Map1b T C 13: 99,432,739 N1158S unknown Het
Masp1 T A 16: 23,494,637 N183Y probably damaging Het
Mdga2 A G 12: 66,568,926 Y636H probably benign Het
Micalcl T A 7: 112,381,610 S264T probably damaging Het
Mif A G 10: 75,859,541 V95A possibly damaging Het
Mmp17 G A 5: 129,595,088 probably null Het
Mmp23 T C 4: 155,650,717 R390G possibly damaging Het
Ncoa6 A C 2: 155,415,222 S800R possibly damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nr2e3 A T 9: 59,949,205 S67R probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr1256 G A 2: 89,835,172 R258* probably null Het
Olfr172 C T 16: 58,760,853 E108K probably damaging Het
Olfr591 T A 7: 103,173,451 Y62F probably benign Het
Olfr845 C T 9: 19,338,652 S64F probably benign Het
Olfr872 A C 9: 20,260,432 Q197H possibly damaging Het
Olfr916 T G 9: 38,657,718 I225L probably damaging Het
Olfr958 A T 9: 39,550,784 V29E possibly damaging Het
Otog A T 7: 46,259,264 H562L possibly damaging Het
Pcdh15 T C 10: 74,594,191 V1250A probably damaging Het
Pde1c A G 6: 56,173,607 V309A possibly damaging Het
Phc3 G T 3: 30,936,575 Q498K possibly damaging Het
Phlpp1 T C 1: 106,392,319 V1348A probably damaging Het
Pik3ap1 T C 19: 41,321,558 D441G probably damaging Het
Pkd1l2 T C 8: 117,065,500 probably null Het
Pla2g4a T C 1: 149,857,686 probably null Het
Pola2 A T 19: 5,948,406 I376N probably damaging Het
Pold2 T A 11: 5,876,833 N34Y probably damaging Het
Ppp2r5c T C 12: 110,554,886 L281P probably damaging Het
Prss46 A G 9: 110,849,635 I29V probably benign Het
Ranbp6 A T 19: 29,811,446 V502E probably benign Het
Rdh14 T C 12: 10,394,613 F155L probably damaging Het
Rnaseh2a A T 8: 84,965,858 probably null Het
Rpp30 A G 19: 36,094,385 T118A possibly damaging Het
Rragd T C 4: 32,996,005 F117L probably damaging Het
S100a2 T A 3: 90,591,292 probably null Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Sh3tc2 A G 18: 62,008,488 E1080G probably damaging Het
Slc26a9 A G 1: 131,750,677 K27R probably damaging Het
Spata17 T A 1: 187,193,994 K46N probably damaging Het
St14 A C 9: 31,108,215 D103E probably benign Het
St6galnac2 T A 11: 116,684,347 Q222L possibly damaging Het
Tdrd9 T C 12: 112,036,410 V831A probably damaging Het
Tert A G 13: 73,642,056 E843G probably damaging Het
Tex21 A G 12: 76,204,270 V464A probably benign Het
Tmem232 T A 17: 65,484,501 H124L probably damaging Het
Tmem5 A G 10: 122,090,479 W243R probably damaging Het
Tnfrsf19 T G 14: 61,005,106 S110R probably damaging Het
Tnnt3 A T 7: 142,515,825 K272* probably null Het
Tnxb T C 17: 34,711,503 L2054P probably damaging Het
Trcg1 A C 9: 57,242,465 D440A probably benign Het
Trpm3 A G 19: 22,901,221 E504G probably damaging Het
Trpm5 C T 7: 143,082,889 R437H probably benign Het
Ttn T C 2: 76,741,167 R18134G probably damaging Het
Uchl5 A C 1: 143,798,422 M64L possibly damaging Het
Urb1 G A 16: 90,753,863 R2034W probably damaging Het
Usp44 T A 10: 93,847,186 C452* probably null Het
Uvssa G A 5: 33,413,934 A641T probably damaging Het
Vmn1r204 T A 13: 22,557,078 I293N probably benign Het
Vmn2r84 A T 10: 130,389,268 C458S probably benign Het
Vmn2r85 T G 10: 130,425,919 H183P probably damaging Het
Vps13d G T 4: 145,105,861 T2825K probably benign Het
Zc3hc1 T A 6: 30,376,025 I179F probably benign Het
Zfp112 A G 7: 24,125,785 N393D probably damaging Het
Zfp558 A G 9: 18,456,563 S310P possibly damaging Het
Zfp560 A C 9: 20,348,775 probably null Het
Zfp668 C T 7: 127,867,080 E311K probably benign Het
Zfp763 T A 17: 33,033,302 M1L probably benign Het
Zfp947 A T 17: 22,145,832 M287K probably benign Het
Other mutations in Pfkfb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Pfkfb4 APN 9 108999134 missense probably damaging 1.00
IGL01978:Pfkfb4 APN 9 109028942 missense probably damaging 1.00
IGL02119:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02121:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02122:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02123:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02125:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02126:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02506:Pfkfb4 APN 9 109030336 missense probably benign 0.00
IGL02881:Pfkfb4 APN 9 109007296 missense probably null 1.00
R0087:Pfkfb4 UTSW 9 109007701 missense probably damaging 1.00
R0101:Pfkfb4 UTSW 9 109010643 missense probably benign 0.03
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0379:Pfkfb4 UTSW 9 109027742 splice site probably benign
R0511:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1490:Pfkfb4 UTSW 9 109027620 missense probably damaging 1.00
R1932:Pfkfb4 UTSW 9 108999169 missense probably damaging 1.00
R2214:Pfkfb4 UTSW 9 109005609 missense probably benign 0.17
R3112:Pfkfb4 UTSW 9 109025042 splice site probably benign
R5470:Pfkfb4 UTSW 9 109027593 missense probably damaging 1.00
R5646:Pfkfb4 UTSW 9 109008421 missense probably damaging 1.00
R5930:Pfkfb4 UTSW 9 109030394 unclassified probably benign
R6139:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R6632:Pfkfb4 UTSW 9 109009562 intron probably null
R6873:Pfkfb4 UTSW 9 109010335 intron probably null
R6958:Pfkfb4 UTSW 9 109010547 missense probably damaging 1.00
R7098:Pfkfb4 UTSW 9 108999154 missense not run
R7131:Pfkfb4 UTSW 9 109007302 missense not run
R7148:Pfkfb4 UTSW 9 109027608 missense not run
Predicted Primers PCR Primer
(F):5'- GCACTGCTGAGCACATCTCTCTATG -3'
(R):5'- GGCACGGTTAGTGACTTGCATTTC -3'

Sequencing Primer
(F):5'- GCACATCTCTCTATGAGAGGCTG -3'
(R):5'- AAATGAGGTATCACTGTGTCCCG -3'
Posted On2014-04-13