Incidental Mutation 'R1517:Scn9a'
ID167080
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Namesodium channel, voltage-gated, type IX, alpha
SynonymsPN1
MMRRC Submission 039563-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1517 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66480080-66634962 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 66505027 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
Predicted Effect probably benign
Transcript: ENSMUST00000100063
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100064
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112354
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152740
Predicted Effect probably benign
Transcript: ENSMUST00000164384
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169900
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,971,814 K375R possibly damaging Het
Adrb2 T C 18: 62,178,800 N318S probably damaging Het
Akap5 A C 12: 76,329,262 E489D possibly damaging Het
Aldh7a1 T A 18: 56,532,061 I385F probably damaging Het
Astn1 T A 1: 158,579,576 probably benign Het
Atp7b T A 8: 21,997,358 T1314S probably damaging Het
Bhmt2 C A 13: 93,662,339 G325C probably damaging Het
Brpf1 T A 6: 113,319,089 V781E probably benign Het
Cacna1c T A 6: 118,598,759 Y1860F probably benign Het
Ccdc7a T C 8: 129,061,681 T56A probably damaging Het
Cep78 A G 19: 15,959,663 S560P probably damaging Het
Cnot1 G A 8: 95,743,213 T1343I probably benign Het
Coq10b T C 1: 55,064,257 S65P probably damaging Het
Creld1 T A 6: 113,489,784 C243S probably damaging Het
Cst12 A T 2: 148,793,252 I121F possibly damaging Het
Cyp26a1 A C 19: 37,698,860 E165A probably benign Het
Cyp2d12 T G 15: 82,558,136 M273R probably damaging Het
Dnajb7 T A 15: 81,407,456 S227C probably damaging Het
Evc T A 5: 37,319,035 Q390L probably damaging Het
F830016B08Rik T A 18: 60,300,898 L351* probably null Het
Fga T C 3: 83,031,838 S507P probably benign Het
Gba A T 3: 89,206,148 Y239F probably damaging Het
Golga2 C A 2: 32,305,984 Y843* probably null Het
Gria4 C A 9: 4,793,865 L64F probably damaging Het
Hectd3 A G 4: 117,002,994 Y803C probably damaging Het
Hmcn1 T C 1: 150,669,421 K2812E probably damaging Het
Il17b T G 18: 61,690,245 V50G probably damaging Het
Itga2b A T 11: 102,466,325 L243* probably null Het
Kank4 C A 4: 98,779,029 V394L possibly damaging Het
Kat14 T A 2: 144,373,791 D65E probably benign Het
Kcnh3 T C 15: 99,238,209 Y696H probably damaging Het
Kctd19 C A 8: 105,395,376 D180Y probably damaging Het
Klra8 A C 6: 130,115,640 S233A probably benign Het
Masp2 A T 4: 148,612,106 T387S possibly damaging Het
Midn C A 10: 80,154,123 T275N probably damaging Het
Mis18bp1 A G 12: 65,133,813 F965L probably benign Het
Myo3a G T 2: 22,282,634 V186L probably damaging Het
Ncoa2 T A 1: 13,165,057 N884I probably benign Het
Olfr1082 T A 2: 86,594,604 T75S probably damaging Het
Olfr272 A T 4: 52,911,502 C97* probably null Het
Olfr963 T C 9: 39,669,720 I221T probably damaging Het
Osr2 T C 15: 35,300,667 V123A probably benign Het
P4ha2 A G 11: 54,117,645 H226R probably benign Het
Pcdhb16 T A 18: 37,478,098 V37E probably benign Het
Pcdhb18 T A 18: 37,489,620 M1K probably null Het
Pcsk1 T A 13: 75,098,047 Y181* probably null Het
Pros1 G T 16: 62,885,512 C63F probably damaging Het
Ranbp3l T A 15: 9,065,001 C353* probably null Het
Rev3l T C 10: 39,838,443 Y2388H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl12-ps1 G T 1: 36,958,377 noncoding transcript Het
Rttn T C 18: 89,113,350 V1951A probably benign Het
Sdk1 T C 5: 142,127,836 F1546S probably damaging Het
Sh3glb2 C T 2: 30,354,975 R71Q probably damaging Het
Slc30a6 T C 17: 74,408,847 F101L probably benign Het
Snrpd1 T C 18: 10,626,913 I60T probably damaging Het
Sox10 T A 15: 79,159,178 E218D probably benign Het
Tekt3 C A 11: 63,070,490 H162N probably damaging Het
Tnfsf13 T C 11: 69,684,738 S246G possibly damaging Het
Trim10 T A 17: 36,872,454 I214N probably damaging Het
Trp63 C A 16: 25,889,253 D566E probably damaging Het
Uck2 T C 1: 167,234,724 D156G probably damaging Het
Zfp386 T A 12: 116,059,605 S314R possibly damaging Het
Zfp467 C T 6: 48,438,236 R494H probably damaging Het
Zfp735 A T 11: 73,710,644 D138V probably benign Het
Zfyve26 T C 12: 79,252,151 E445G probably damaging Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66563601 missense probably damaging 1.00
IGL00570:Scn9a APN 2 66484142 missense probably damaging 1.00
IGL00809:Scn9a APN 2 66483935 missense probably damaging 1.00
IGL00977:Scn9a APN 2 66484301 missense probably damaging 0.99
IGL01120:Scn9a APN 2 66526972 missense probably benign 0.00
IGL01134:Scn9a APN 2 66504968 missense probably damaging 1.00
IGL01300:Scn9a APN 2 66488053 nonsense probably null
IGL01452:Scn9a APN 2 66527072 missense probably damaging 1.00
IGL01531:Scn9a APN 2 66537378 missense probably benign 0.11
IGL01572:Scn9a APN 2 66493886 missense probably benign 0.00
IGL01645:Scn9a APN 2 66487642 missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66484042 missense probably damaging 1.00
IGL01965:Scn9a APN 2 66484433 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66547135 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66494826 missense probably damaging 1.00
IGL02166:Scn9a APN 2 66493103 missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66484611 splice site probably benign
IGL02640:Scn9a APN 2 66536096 critical splice donor site probably null
IGL02685:Scn9a APN 2 66537293 missense probably damaging 1.00
IGL02798:Scn9a APN 2 66540559 missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66568029 missense probably damaging 1.00
IGL03008:Scn9a APN 2 66562511 missense probably damaging 1.00
IGL03270:Scn9a APN 2 66484014 missense probably damaging 1.00
IGL03408:Scn9a APN 2 66526747 missense probably benign 0.00
R0039:Scn9a UTSW 2 66562444 missense probably damaging 0.98
R0173:Scn9a UTSW 2 66533093 missense probably damaging 1.00
R0323:Scn9a UTSW 2 66568131 missense probably damaging 1.00
R0344:Scn9a UTSW 2 66505010 missense probably damaging 0.99
R0421:Scn9a UTSW 2 66543277 missense probably benign
R0465:Scn9a UTSW 2 66526996 missense probably damaging 1.00
R0514:Scn9a UTSW 2 66483678 missense probably damaging 1.00
R0599:Scn9a UTSW 2 66526799 missense probably damaging 0.96
R0627:Scn9a UTSW 2 66537377 missense probably benign 0.00
R0644:Scn9a UTSW 2 66533061 critical splice donor site probably null
R0653:Scn9a UTSW 2 66533377 missense probably damaging 1.00
R0685:Scn9a UTSW 2 66483499 missense probably benign 0.02
R0718:Scn9a UTSW 2 66547112 missense probably damaging 1.00
R0827:Scn9a UTSW 2 66536124 nonsense probably null
R0890:Scn9a UTSW 2 66483735 missense probably damaging 1.00
R1139:Scn9a UTSW 2 66504997 missense probably benign 0.02
R1385:Scn9a UTSW 2 66563542 missense probably damaging 1.00
R1398:Scn9a UTSW 2 66484586 missense probably benign 0.11
R1496:Scn9a UTSW 2 66526888 missense probably benign
R1511:Scn9a UTSW 2 66526813 missense probably benign 0.01
R1564:Scn9a UTSW 2 66484304 missense probably damaging 1.00
R1634:Scn9a UTSW 2 66488017 missense probably damaging 1.00
R1662:Scn9a UTSW 2 66483459 missense probably benign 0.00
R1695:Scn9a UTSW 2 66504876 nonsense probably null
R1709:Scn9a UTSW 2 66483506 missense probably damaging 1.00
R1741:Scn9a UTSW 2 66487594 missense probably damaging 0.99
R1755:Scn9a UTSW 2 66501716 missense probably benign 0.38
R1914:Scn9a UTSW 2 66566250 missense probably damaging 1.00
R1962:Scn9a UTSW 2 66484311 missense probably damaging 1.00
R1970:Scn9a UTSW 2 66515380 missense probably damaging 0.97
R2017:Scn9a UTSW 2 66515321 missense probably damaging 0.99
R2092:Scn9a UTSW 2 66533376 missense probably damaging 0.99
R2105:Scn9a UTSW 2 66568183 missense probably benign 0.25
R2114:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2115:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2128:Scn9a UTSW 2 66526654 missense probably damaging 1.00
R2157:Scn9a UTSW 2 66536325 missense probably damaging 1.00
R2162:Scn9a UTSW 2 66534229 missense probably damaging 0.98
R2350:Scn9a UTSW 2 66504968 missense probably damaging 1.00
R3694:Scn9a UTSW 2 66562405 missense probably benign
R3771:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3772:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3773:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3922:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66565054 intron probably benign
R4385:Scn9a UTSW 2 66484556 missense probably damaging 1.00
R4415:Scn9a UTSW 2 66526693 missense probably damaging 1.00
R4570:Scn9a UTSW 2 66483558 missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66547018 missense probably benign
R4783:Scn9a UTSW 2 66540623 missense probably benign 0.01
R4822:Scn9a UTSW 2 66483749 missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66551713 missense probably benign
R4908:Scn9a UTSW 2 66526743 missense probably benign 0.03
R4983:Scn9a UTSW 2 66566270 missense probably benign 0.02
R5047:Scn9a UTSW 2 66562480 missense probably damaging 1.00
R5100:Scn9a UTSW 2 66534119 missense probably damaging 1.00
R5140:Scn9a UTSW 2 66565167 missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66488043 missense probably damaging 1.00
R5557:Scn9a UTSW 2 66547103 missense probably damaging 0.99
R5582:Scn9a UTSW 2 66565029 intron probably benign
R6108:Scn9a UTSW 2 66484049 missense probably damaging 1.00
R6115:Scn9a UTSW 2 66563629 missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66487524 missense probably benign 0.00
R6261:Scn9a UTSW 2 66483896 missense probably damaging 1.00
R6335:Scn9a UTSW 2 66568264 start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66526963 missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66483502 missense probably benign 0.23
R6681:Scn9a UTSW 2 66563342 missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66568029 missense probably damaging 1.00
X0003:Scn9a UTSW 2 66508647 missense probably benign 0.02
X0062:Scn9a UTSW 2 66568077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCGTGAAAATTAGCACCCTGTCTT -3'
(R):5'- TTTATGCAGGAGCTGCAAACCAGA -3'

Sequencing Primer
(F):5'- cccactcccctacctacc -3'
(R):5'- CTGCAAACCAGAGGAAGGC -3'
Posted On2014-04-13