Incidental Mutation 'R1517:Olfr1082'
ID167081
Institutional Source Beutler Lab
Gene Symbol Olfr1082
Ensembl Gene ENSMUSG00000111689
Gene Nameolfactory receptor 1082
SynonymsGA_x6K02T2Q125-48079993-48079157, MOR192-4_p
MMRRC Submission 039563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R1517 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86593412-86598966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86594604 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 75 (T75S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215600]
Predicted Effect probably damaging
Transcript: ENSMUST00000111578
AA Change: T75S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107204
Gene: ENSMUSG00000079239
AA Change: T75S

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.6e-31 PFAM
Pfam:7tm_4 139 283 4.5e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111579
AA Change: T75S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107205
Gene: ENSMUSG00000079239
AA Change: T75S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-48 PFAM
Pfam:7tm_1 41 290 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215600
AA Change: T75S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,971,814 K375R possibly damaging Het
Adrb2 T C 18: 62,178,800 N318S probably damaging Het
Akap5 A C 12: 76,329,262 E489D possibly damaging Het
Aldh7a1 T A 18: 56,532,061 I385F probably damaging Het
Astn1 T A 1: 158,579,576 probably benign Het
Atp7b T A 8: 21,997,358 T1314S probably damaging Het
Bhmt2 C A 13: 93,662,339 G325C probably damaging Het
Brpf1 T A 6: 113,319,089 V781E probably benign Het
Cacna1c T A 6: 118,598,759 Y1860F probably benign Het
Ccdc7a T C 8: 129,061,681 T56A probably damaging Het
Cep78 A G 19: 15,959,663 S560P probably damaging Het
Cnot1 G A 8: 95,743,213 T1343I probably benign Het
Coq10b T C 1: 55,064,257 S65P probably damaging Het
Creld1 T A 6: 113,489,784 C243S probably damaging Het
Cst12 A T 2: 148,793,252 I121F possibly damaging Het
Cyp26a1 A C 19: 37,698,860 E165A probably benign Het
Cyp2d12 T G 15: 82,558,136 M273R probably damaging Het
Dnajb7 T A 15: 81,407,456 S227C probably damaging Het
Evc T A 5: 37,319,035 Q390L probably damaging Het
F830016B08Rik T A 18: 60,300,898 L351* probably null Het
Fga T C 3: 83,031,838 S507P probably benign Het
Gba A T 3: 89,206,148 Y239F probably damaging Het
Golga2 C A 2: 32,305,984 Y843* probably null Het
Gria4 C A 9: 4,793,865 L64F probably damaging Het
Hectd3 A G 4: 117,002,994 Y803C probably damaging Het
Hmcn1 T C 1: 150,669,421 K2812E probably damaging Het
Il17b T G 18: 61,690,245 V50G probably damaging Het
Itga2b A T 11: 102,466,325 L243* probably null Het
Kank4 C A 4: 98,779,029 V394L possibly damaging Het
Kat14 T A 2: 144,373,791 D65E probably benign Het
Kcnh3 T C 15: 99,238,209 Y696H probably damaging Het
Kctd19 C A 8: 105,395,376 D180Y probably damaging Het
Klra8 A C 6: 130,115,640 S233A probably benign Het
Masp2 A T 4: 148,612,106 T387S possibly damaging Het
Midn C A 10: 80,154,123 T275N probably damaging Het
Mis18bp1 A G 12: 65,133,813 F965L probably benign Het
Myo3a G T 2: 22,282,634 V186L probably damaging Het
Ncoa2 T A 1: 13,165,057 N884I probably benign Het
Olfr272 A T 4: 52,911,502 C97* probably null Het
Olfr963 T C 9: 39,669,720 I221T probably damaging Het
Osr2 T C 15: 35,300,667 V123A probably benign Het
P4ha2 A G 11: 54,117,645 H226R probably benign Het
Pcdhb16 T A 18: 37,478,098 V37E probably benign Het
Pcdhb18 T A 18: 37,489,620 M1K probably null Het
Pcsk1 T A 13: 75,098,047 Y181* probably null Het
Pros1 G T 16: 62,885,512 C63F probably damaging Het
Ranbp3l T A 15: 9,065,001 C353* probably null Het
Rev3l T C 10: 39,838,443 Y2388H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl12-ps1 G T 1: 36,958,377 noncoding transcript Het
Rttn T C 18: 89,113,350 V1951A probably benign Het
Scn9a G A 2: 66,505,027 probably benign Het
Sdk1 T C 5: 142,127,836 F1546S probably damaging Het
Sh3glb2 C T 2: 30,354,975 R71Q probably damaging Het
Slc30a6 T C 17: 74,408,847 F101L probably benign Het
Snrpd1 T C 18: 10,626,913 I60T probably damaging Het
Sox10 T A 15: 79,159,178 E218D probably benign Het
Tekt3 C A 11: 63,070,490 H162N probably damaging Het
Tnfsf13 T C 11: 69,684,738 S246G possibly damaging Het
Trim10 T A 17: 36,872,454 I214N probably damaging Het
Trp63 C A 16: 25,889,253 D566E probably damaging Het
Uck2 T C 1: 167,234,724 D156G probably damaging Het
Zfp386 T A 12: 116,059,605 S314R possibly damaging Het
Zfp467 C T 6: 48,438,236 R494H probably damaging Het
Zfp735 A T 11: 73,710,644 D138V probably benign Het
Zfyve26 T C 12: 79,252,151 E445G probably damaging Het
Other mutations in Olfr1082
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0483:Olfr1082 UTSW 2 86594408 missense probably benign 0.07
R0675:Olfr1082 UTSW 2 86594079 missense probably benign 0.00
R0718:Olfr1082 UTSW 2 86594081 missense probably benign 0.01
R0727:Olfr1082 UTSW 2 86594380 nonsense probably null
R1850:Olfr1082 UTSW 2 86594104 nonsense probably null
R2430:Olfr1082 UTSW 2 86594708 missense probably benign 0.00
R2474:Olfr1082 UTSW 2 86594613 missense probably benign 0.00
R3009:Olfr1082 UTSW 2 86594370 missense probably benign 0.07
R3122:Olfr1082 UTSW 2 86594610 missense possibly damaging 0.91
R4006:Olfr1082 UTSW 2 86594564 missense probably benign 0.14
R4007:Olfr1082 UTSW 2 86594564 missense probably benign 0.14
R4581:Olfr1082 UTSW 2 86594228 missense probably benign 0.08
R4762:Olfr1082 UTSW 2 86594037 missense possibly damaging 0.60
R5617:Olfr1082 UTSW 2 86594001 missense probably benign 0.07
R6118:Olfr1082 UTSW 2 86594414 missense probably benign
R6140:Olfr1082 UTSW 2 86594104 nonsense probably null
R6313:Olfr1082 UTSW 2 86594067 missense possibly damaging 0.76
R6528:Olfr1082 UTSW 2 86594465 missense probably damaging 1.00
R6785:Olfr1082 UTSW 2 86594421 missense probably damaging 0.98
R6792:Olfr1082 UTSW 2 86593939 missense probably benign 0.09
R6857:Olfr1082 UTSW 2 86594264 missense probably damaging 1.00
R6998:Olfr1082 UTSW 2 86594144 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAACCACTGTCAGGTGGGACC -3'
(R):5'- TGGGAATCACTGAGAACCCTGAGC -3'

Sequencing Primer
(F):5'- AGGTCATTGTGACTAGAACCC -3'
(R):5'- CAATGTAGACGCCAAGCTAC -3'
Posted On2014-04-13